Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5933

Zmiz1 zinc finger, MIZ-type containing 1 ( MGI:3040693)
TS16 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:5933 EMAGE:5933
Figure 6A. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2007.10.005] Gene Expr Patterns 8: 206-13, Rodriguez-Magadan H; Merino E; Schnabel D; Ramirez L; Lomeli H, "Spatial and temporal expression of Zimp7 and Zimp10 PIAS-like proteins in the developing mouse embryo." Copyright 2008. [PMID:18053775] Figure 6B. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2007.10.005] Gene Expr Patterns 8: 206-13, Rodriguez-Magadan H; Merino E; Schnabel D; Ramirez L; Lomeli H, "Spatial and temporal expression of Zimp7 and Zimp10 PIAS-like proteins in the developing mouse embryo." Copyright 2008. [PMID:18053775]

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Fig6B: Parasagittal section of embryo in A at the midline level. Image annotations: BA, branchial arches; FL, forelimb; Fb, forebrain; HL, hindlimb; OV, optical vesicle; OtV, otic vesicle; TV, telencephalic vesicle; VCh, ventricular chamber.
Expression Pattern Description
Spatial Annotation:
EMAGE:5933Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5933_wholemount__moderate.wlz
5933_wholemount__weak.wlz
5933_wholemount__notDetected.wlz
5933_wholemount__strong.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5933_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
1st branchial arch mandibular component
detected detected
forelimb bud
detected detected
hindlimb bud
detected detected
trunk somite
detected detected
telencephalon
detected detected
optic cup
detected detected
otocyst
detected detected
future brain
detected detected
homogeneousSagittal sections of these embryos demonstrated that Zimp10 transcripts are present in all the brain regions
dorsal aorta
not detected not detected
homogeneousAt this stage the dorsal aorta did not longer show a positive signal
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:3775938
Entity Detected:Zmiz1, zinc finger, MIZ-type containing 1 ( MGI:3040693)
Sequence:sense strand is shown

>MGI:3775938
ATGAATTCTATGGACAGGCACATCCAGCAGACCAATGACCGTCTGCAGTGCATCAAGCAGCACTTACAGA
ACCCCGCCAACTTCCACAATGCTGCTACAGAGCTGCTGGATTGGTGTGGAGACCCTCGAGCCTTCCAGAG
GCCCTTTGAGCAGAGCCTCATGGGCTGCCTGACGGTTGTCAGCCGTGTGGCTGCCCAACAAGGGTTTGAC
CTGGACCTGGGCTACAGACTCTTGGCTGTGTGCGCCGCAAATCGAGACAAGTTCACCCCCAAGTCTGCTG
CCCTGCTGTCCTCCTGGTGTGAAGAACTTGGCCGCCTGCTGCTGCTGCGACATCAGAAGAGCCGCCAGAA
CGACCCCCCTGGGAAACTGCCCATGCAGCCCCCCCTCAGCTCCATGAGCTCCATGAAACCCACTCTGTCG
CACAGTGATGGGTCATTTCCTTATGACTCTGTCCCTTGGCAGCAGAACACCAATCAGCCTCCCGGCTCCC
TCTCCGTGGTC
nt 500 - nt 1000 of NM_183208.2
Notes:The Zmiz1 (Zimp10) probe template used in this study by Rodriguez-Magadan et al., 2008 [PMID:18053775] "was obtained by subcloning into pKS vector a fragment corresponding to bases 1-500 of the coding sequence from the complete cDNA clone". "This vector was linearized with HinDIII for the antisense probe or NotI for the sense probe".
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:10.5 dpc
Theiler Stage:TS16
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Rodriguez-Magadan H; Merino E; Schnabel D; Ramirez L; Lomeli H, 2008 [PMID:18053775] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/j.modgep.2007.10.005] [ PMID:18053775] Rodriguez-Magad�n H, Merino E, Schnabel D, Ram�rez L, Lomel� H 2008 Spatial and temporal expression of Zimp7 and Zimp10 PIAS-like proteins in the developing mouse embryo. Gene Expr Patterns (8):206-13
Links:MGI:3775941 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI