Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5936

Lingo1 leucine rich repeat and Ig domain containing 1 ( MGI:1915522)
TS18 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:5936 EMAGE:5936 EMAGE:5936 EMAGE:5936 EMAGE:5936
Figure 2I. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2007.10.003] Gene Expr Patterns 2008; 8: 79-86 Haines BP; Rigby PW, "Expression of the Lingo/LERN gene family during mouse embryogenesis." Copyright 2008. [PMID:18297755] Figure 2J. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2007.10.003] Gene Expr Patterns 2008; 8: 79-86 Haines BP; Rigby PW, "Expression of the Lingo/LERN gene family during mouse embryogenesis." Copyright 2008. [PMID:18297755] Figure 2K. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2007.10.003] Gene Expr Patterns 2008; 8: 79-86 Haines BP; Rigby PW, "Expression of the Lingo/LERN gene family during mouse embryogenesis." Copyright 2008. [PMID:18297755] Figure 2L. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2007.10.003] Gene Expr Patterns 2008; 8: 79-86 Haines BP; Rigby PW, "Expression of the Lingo/LERN gene family during mouse embryogenesis." Copyright 2008. [PMID:18297755] Figure 2M. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2007.10.003] Gene Expr Patterns 2008; 8: 79-86 Haines BP; Rigby PW, "Expression of the Lingo/LERN gene family during mouse embryogenesis." Copyright 2008. [PMID:18297755]
EMAGE:5936 EMAGE:5936 EMAGE:5936 EMAGE:5936 EMAGE:5936
Figure 2N. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2007.10.003] Gene Expr Patterns 2008; 8: 79-86 Haines BP; Rigby PW, "Expression of the Lingo/LERN gene family during mouse embryogenesis." Copyright 2008. [PMID:18297755] Figure 2O. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2007.10.003] Gene Expr Patterns 2008; 8: 79-86 Haines BP; Rigby PW, "Expression of the Lingo/LERN gene family during mouse embryogenesis." Copyright 2008. [PMID:18297755] Figure 2P. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2007.10.003] Gene Expr Patterns 2008; 8: 79-86 Haines BP; Rigby PW, "Expression of the Lingo/LERN gene family during mouse embryogenesis." Copyright 2008. [PMID:18297755] Figure 2Q. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2007.10.003] Gene Expr Patterns 2008; 8: 79-86 Haines BP; Rigby PW, "Expression of the Lingo/LERN gene family during mouse embryogenesis." Copyright 2008. [PMID:18297755] Figure 2R. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2007.10.003] Gene Expr Patterns 2008; 8: 79-86 Haines BP; Rigby PW, "Expression of the Lingo/LERN gene family during mouse embryogenesis." Copyright 2008. [PMID:18297755]
EMAGE:5936 EMAGE:5936
Figure 2S. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2007.10.003] Gene Expr Patterns 2008; 8: 79-86 Haines BP; Rigby PW, "Expression of the Lingo/LERN gene family during mouse embryogenesis." Copyright 2008. [PMID:18297755] Figure 2T. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2007.10.003] Gene Expr Patterns 2008; 8: 79-86 Haines BP; Rigby PW, "Expression of the Lingo/LERN gene family during mouse embryogenesis." Copyright 2008. [PMID:18297755]

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Note: trigeminal (tg), facio-acoustic (fa) and the dorsal root (drg) ganglia; midbrain (mb); hindbrain (hb; dermomyotome (dm); somites (s); interlimb somites (is). The approximate plane of sections J-N is shown in lower case letters in I.
Expression Pattern Description
Spatial Annotation:
EMAGE:5936Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5936_wholemount__moderate.wlz
5936_wholemount__weak.wlz
5936_wholemount__possible.wlz
5936_wholemount__notDetected.wlz
5936_wholemount__strong.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5936_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
trigeminal v ganglion
detected detected
facial vii ganglion
detected detected
acoustic viii ganglion
detected detected
dorsal root ganglion
detected detected
hindbrain
detected detected
midbrain
detected detected
neural tube
detected detected
regionalExpression along the length of the neural tube in lateral cells and the motor horn.
tail neural tube
detected detected
regionalExpression along the length of the neural tube in lateral cells and the motor horn.
otocyst
detected detected
Expression is seen in the epithelium of the otic vesicle
trunk somite
detected detected
regionalExpression is present at the inner surface of the dermomyotome (dm) in the ventro-caudal corner of the developing somites. Additional expression is seen in the ventral interlimb somites
genitourinary system
detected detected
regionalExpression detected in the epithelium underlying the urogenital ridge.
liver and biliary system
detected detected
regionalExpression in the epithelium of the hepatic primordium.
neural tube lateral wall
detected detected
Expression along the length of the neural tube in lateral cells and the motor horn.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1967999
Entity Detected:Lingo1, leucine rich repeat and Ig domain containing 1 ( MGI:1915522)
Sequence:sense strand is shown

>MGI:1967999
CTTGAGCGGATTCCTGCCCCCACCTGGTTACAGAATCTCCTTGTGCTTCAGGATTCGGTCAAGCATTGGA
CCAATCACGTGCATGCTGAGACTGAGCCCCGAAGGCTGCTGTGTCCTCAGGCCTTTGGCAGCCCCTCTGC
TTGGCTCCCTGTGCCATCTGACCCAGGAGTCACGTGAGCCTCCCTCTGGGATCTGGCATGAAGGAGAAAT
GGATTCTGGCTTTCCCGCTCTGGCTTTCCCTGACTTCTCCAGAATCTAAGAAGTGTCCTGAGGCATCTCT
TGCTCTACCTCAGCCCAGAATCCCTGAGGATCCATCCAGAAATCCAACGACTTCAAGACCTAAAAACATC
AGGCCCCTCTCCCTGGACACAGACTTGACAGAAGTGGCCAGTTCATCAGGTGAGCGAGAGGATGCTGGCA
GGGGGTATGAGAAGCATGCCCAGCCCCCTCCTGGCCTGCTGGCAGCCCATCCTCCTGCTGGTACTGGGCT
CAGTGCTGTCAGGCTCTGCTACAGGCTGCCCGCCCCGCTGCGAGTGCTCAGCGCAGGACCGAGCCGTGCT
CTGCCACCGCAAACGCTTTGTGGCGGTGCCCGAGGGCATCCCCACCGAGACTCGCCTGCTGGACCTGGGC
AAAAACCGCATCAAGACACTCAACCAGGACGAGTTTGCCAGCTTCCCACACCTGGAGGAGCTAGAACTCA
ATGAAAACATCGTGAGCGCCGTGGAGCCAGGCGCCTTCAACAACCTCTTCAACCTGAGGACTCTGGGGCT
GCGCAGCAACCGCCTGA
nt 1 - nt 787 of BC065696.1
Notes:The Lingo1 (LERN1) probe used in this study by Haines & Rigby, 2008 [PMID:18297755] "was obtained from IMAGE clone 5685897. A clone for riboprobe synthesis was obtained by digesting with EcoRI and HindIII and ligating into pBluescipt II KS. An antisense probe was generated by digesting with EcoRI and transcribing with T3 RNA polymerase." Editor's note: IMAGE:5685897 was created by priming first strand cDNA synthesis with an oligo-dT primer containing a NotI site. Double stranded cDNA was subsequently ligated with an EcoRI adaptor, digested with NotI, and then cloned directionally into pYX-Asc vector. BC065696.1 is the full 2661bp insert sequence from IMAGE:5685897, which is cut by HindIII at position 787. pYX-Asc does not contain a HindIII site (see http://www.imagenes-bio.de/info/vectors/pYX-Asc.shtml). Therefore the EcoRI and HindIII cloned fragment corresponds to nt 1-787 of BC065696.1.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:10.5 dpc
Theiler Stage:TS18
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Haines BP & Rigby PW, 2008 [PMID:18297755] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/j.modgep.2007.10.003] [ PMID:18297755] Haines BP, Rigby PW 2008 Expression of the Lingo/LERN gene family during mouse embryogenesis. Gene Expr Patterns (8):79-86
Links:MGI:3789594 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI