Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5937

Lingo2 leucine rich repeat and Ig domain containing 2 ( MGI:2442298)
TS18 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:5937 EMAGE:5937 EMAGE:5937 EMAGE:5937
Figure 4A. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2007.10.003] Gene Expr Patterns 2008; 8: 79-86 Haines BP; Rigby PW, "Expression of the Lingo/LERN gene family during mouse embryogenesis." Copyright 2008. [PMID:18297755] Figure 4B. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2007.10.003] Gene Expr Patterns 2008; 8: 79-86 Haines BP; Rigby PW, "Expression of the Lingo/LERN gene family during mouse embryogenesis." Copyright 2008. [PMID:18297755] Figure 4C. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2007.10.003] Gene Expr Patterns 2008; 8: 79-86 Haines BP; Rigby PW, "Expression of the Lingo/LERN gene family during mouse embryogenesis." Copyright 2008. [PMID:18297755] Figure 4D. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2007.10.003] Gene Expr Patterns 2008; 8: 79-86 Haines BP; Rigby PW, "Expression of the Lingo/LERN gene family during mouse embryogenesis." Copyright 2008. [PMID:18297755]

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
A - lateral view. Forebrain (fb); the approximate planes of sections C and D are indicated. B - frontal view showing expression either side of the midline dorsal to the olfactory pit. C and D - sections indicating expression is adjacent to the olfactory pit epithelium. Olfactory pit (op).
Expression Pattern Description
Spatial Annotation:
EMAGE:5937Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5937_wholemount__possible.wlz
5937_wholemount__notDetected.wlz
5937_wholemount__strong.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5937_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
medial-nasal process mesenchyme
detected detected
regionalExpression is restricted to a group of cells in the head mesoderm, ventral to the forebrain and adjacent to the olfactory pit epithelium.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:3789342
Entity Detected:Lingo2, leucine rich repeat and Ig domain containing 2 ( MGI:2442298)
Sequence:sense strand is shown

>MGI:3789342
GGACGTGAGGTTGAGACCATAGAGGCTGTTGGCTGGCATCAAATCCAACAAAGGCCAATAGTCGATCTCT
AGGTTTTTCAGGTGGAACAATCTTTTAAAGGCATACACAGGCATATTGTTGATATTGAGATGCTTCAGAT
GCAGGGCGATGAGGCTGCGGAGATGGGAAAGGGCTTCTGTTGGTACTGCTGTCAAGTTGCACTTCTCCAG
GGTGAGCTGCTCCAAGCTAAGTAGTCCGCTGAAGGCCCTGTGTGAGATATACACTAAATCATTGTCCCCC
ACTTCTAGAGACTTCAGGTTATGCAGATCCTGGAACATGTAGTCCAGCAAAATGACAATCTTATTCTCAC
TAATGTCAAGCTTGGTGAGGTTGGACAGTCCTGTGAATACTCCTAAAGGGACCAACTTAAGGCGATTGCC
TTTTAGGCGGAGGGAACGCAGGTTAAAGAGATTGTTAAATGCCCCAGGCTCCACATTGGCAATAATGTTG
TCGCTCAAGTCTATCTCCTCCAACAGAGGATATGAGATGAACTCTTCAGGGTTTATGCTCTTTAGTCGAT
TTTTGCTCAGGTCCAAGATTTTGGTCTCAATGGGAATGCCTTCTGGGATCGCGAGCAATCGTCTTCTGTG
GCAGCT
nt 158094 - nt 158729 of AL844208.5
Notes:The Lingo2 (LERN3) probe used in this study by Haines & Rigby, 2008 [PMID:18297755] "was obtained by PCR with Pfu polymerase (Stratagene) using primers 5'-AGCTGCCACAGAAGACGATT and 5'-GGACGTGAGGTTGAGACCAT from the BAC RP23-354D14 which contains the Lingo2/LERN3 gene. The PCR product was cloned into EcoRV digested pBluescript II KS yielding the plasmid LERN3 RT1. Antisense riboprobes were generated by digesting LERN3 RT1 with SalI and transcribing with T7 RNA polymerase".
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:10.5 dpc
Theiler Stage:TS18
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Haines BP & Rigby PW, 2008 [PMID:18297755] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/j.modgep.2007.10.003] [ PMID:18297755] Haines BP, Rigby PW 2008 Expression of the Lingo/LERN gene family during mouse embryogenesis. Gene Expr Patterns (8):79-86
Links:MGI:3789599 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI