Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5938

Lingo3 leucine rich repeat and Ig domain containing 3 ( MGI:3609246)
TS18 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:5938 EMAGE:5938 EMAGE:5938 EMAGE:5938 EMAGE:5938
Figure 3B. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2007.10.003] Gene Expr Patterns 2008; 8: 79-86 Haines BP; Rigby PW, "Expression of the Lingo/LERN gene family during mouse embryogenesis." Copyright 2008. [PMID:18297755] Figure 3F. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2007.10.003] Gene Expr Patterns 2008; 8: 79-86 Haines BP; Rigby PW, "Expression of the Lingo/LERN gene family during mouse embryogenesis." Copyright 2008. [PMID:18297755] Figure 3G. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2007.10.003] Gene Expr Patterns 2008; 8: 79-86 Haines BP; Rigby PW, "Expression of the Lingo/LERN gene family during mouse embryogenesis." Copyright 2008. [PMID:18297755] Figure 3H. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2007.10.003] Gene Expr Patterns 2008; 8: 79-86 Haines BP; Rigby PW, "Expression of the Lingo/LERN gene family during mouse embryogenesis." Copyright 2008. [PMID:18297755] Figure 3I. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2007.10.003] Gene Expr Patterns 2008; 8: 79-86 Haines BP; Rigby PW, "Expression of the Lingo/LERN gene family during mouse embryogenesis." Copyright 2008. [PMID:18297755]

Expression pattern clarity: one star
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Note: The limb bud (lb) (E); branchial arches (ba); neural tube (nt); forebrain (fb). Approximate planes of sections F-I are shown in lower case letters (B).
Expression Pattern Description
Spatial Annotation:
EMAGE:5938Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5938_wholemount__moderate.wlz
5938_wholemount__strong.wlz
5938_wholemount__weak.wlz
5938_wholemount__possible.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5938_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
embryo
weak weak
Low level expression is seen in many tissues with elevated levels in the head (D), the limb bud (H, I) and the branchial arches (G).
limb
detected detected
gut
detected detected
The arrowhead in I shows specific expression in the developing gut.
branchial arch
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:3789600
Entity Detected:Lingo3, leucine rich repeat and Ig domain containing 3 ( MGI:3609246)
Sequence:sense strand is shown

>MGI:3789600
GTGGCGGCGGCGGTGGCAGTGGCGGCCGTGGCGGCGGCTGGTGGCGGCTCCGAGCAGCCCCTCGCGCCGT
CCGAGGAGGAGCCGCCCAGCTGTCCTGGACTATGCTGGCGTGGCCCTAGGCCCCACACCTTGCACCATGA
CCTGCTGGCTGCACATGCTGGGCCTGCACTTGCTGCTGCTGCCCACAGCGCCCCTGGCCGCAGGCTGCCC
CGCACGCTGCGAGTGCTCCGCATCCACCCGCACTGTGGCCTGTGGGCGCCGCCGGCTGACAGCCATCCCC
GAGGGCATCCCGGCCGAAACTCGCATGCTGGAGCTGAGCCGCAACCGCATCCGCTGTCTGAACCCTGGGG
ACCTGGCCTCGTTCCCCACCCTGGAGGAGCTGGACCTCAACCATAATGTGATTGCCCACGTGGAACCTGG
GGCCTTCGCCAACCTGCCCCGCCTGCGCGTCCTGCGTCTCCGTGGCAACCAGCTGAAGCTCATCCCGCCA
GGCGTGTTCACGCATCTGGACAGCCTCACGCTGCTGGACCTGAGCGAGAACAAGCTGGTCATCCTGCTGG
ATTTCAGCTTCCAGGACCTGCGCAGCCTGCAGCGGCTGGAGGTGGGCGACAATGACCTGGTGTTCATCTC
CCGCAGGGCCTTTGCGGGGCTGTTGGGGCTGGCTGAGCTCACGCTGGAGCGCTGCAATCTCACATCACTG
TCCCCGGAGTCGCTGGGTCACCTGCGGGGCTTGGGCGCTCTGCGCCTGCGCCACCTGGCCATCGCCGCCC
TGGAGGACCAGAATTTCCAGA
nt 1 - nt 791 of BC072620.1
Notes:The Lingo3 probe used in this study by Haines & Rigby, 2008 [PMID:18297755] "was obtained from IMAGE clone 6815693. A clone for riboprobe synthesis was obtained by digesting with EcoRI and HindIII and ligating into pBluescript II KS. An antisense probe was generated by digesting with EcoRI and transcribing with T3 RNA polymerase." Editor's note: IMAGE:6815693 was created by priming first strand cDNA synthesis with an oligo-dT primer containing a NotI site. Double stranded cDNA was subsequently ligated with an EcoRI adaptor, digested with NotI, and then cloned directionally into pYX-Asc vector. BC072620.1 is the full 3447bp insert sequence from IMAGE:6815693, which is cut by HindIII at positions 791 and 3029. pYX-Asc does not contain a HindIII site (see http://www.imagenes-bio.de/info/vectors/pYX-Asc.shtml). Therefore the EcoRI and HindIII cloned fragment corresponds to nt 1-791 of BC072620.1.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:10.5 dpc
Theiler Stage:TS18
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Haines BP & Rigby PW, 2008 [PMID:18297755] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/j.modgep.2007.10.003] [ PMID:18297755] Haines BP, Rigby PW 2008 Expression of the Lingo/LERN gene family during mouse embryogenesis. Gene Expr Patterns (8):79-86
Links:MGI:3789598 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI