Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6006

Sulf2 sulfatase 2 ( MGI:1919293)
TS16 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:6006 EMAGE:6006 EMAGE:6006
Fig 1E. [doi:10.1002/dvdy.21423] Copyright: This image is from Ratzka A; Kalus I; Moser M; Dierks T; Mundlos S; Vortkamp A, "Redundant function of the heparan sulfate 6-O-endosulfatases Sulf1 and Sulf2 during skeletal development." Dev Dyn 2008; 237: 339-53. Reprinted with permission of Wiley-Liss Inc. [PMID:18213582] Fig 1I. [doi:10.1002/dvdy.21423] Copyright: This image is from Ratzka A; Kalus I; Moser M; Dierks T; Mundlos S; Vortkamp A, "Redundant function of the heparan sulfate 6-O-endosulfatases Sulf1 and Sulf2 during skeletal development." Dev Dyn 2008; 237: 339-53. Reprinted with permission of Wiley-Liss Inc. [PMID:18213582] Fig 1Q. [doi:10.1002/dvdy.21423] Copyright: This image is from Ratzka A; Kalus I; Moser M; Dierks T; Mundlos S; Vortkamp A, "Redundant function of the heparan sulfate 6-O-endosulfatases Sulf1 and Sulf2 during skeletal development." Dev Dyn 2008; 237: 339-53. Reprinted with permission of Wiley-Liss Inc. [PMID:18213582]

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Note: ect, ectoderm; fl, forelimb; fp, floor plate; hl, hindlimb.
Expression Pattern Description
Spatial Annotation:
EMAGE:6006Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6006_wholemount__moderate.wlz
6006_wholemount__strong.wlz
6006_wholemount__possible.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6006_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
telencephalon
detected detected
Broad expression, with partially overlapping regions to Sulf1 in the telencephalic vesicle, the nasal placodes, the somites, the tip of the tail, and the floor plate.
trunk somite
detected detected
Broad expression, with partially overlapping regions to Sulf1 in the telencephalic vesicle, the nasal placodes, the somites, the tip of the tail, and the floor plate.
olfactory pit
detected detected
Broad expression, with partially overlapping regions to Sulf1 in the telencephalic vesicle, the nasal placodes, the somites, the tip of the tail, and the floor plate.
neural tube floor plate
detected detected
Broad expression, with partially overlapping regions to Sulf1 in the telencephalic vesicle, the nasal placodes, the somites, the tip of the tail, and the floor plate.
forelimb bud apical ectodermal ridge
not detected not detected
homogeneous
forelimb bud mesenchyme
strong strong
hindlimb bud mesenchyme
strong strong
1st branchial arch mandibular component mesenchyme
strong strong
1st branchial arch maxillary component mesenchyme
strong strong
1st branchial arch mandibular component ectoderm
not detected not detected
homogeneous
1st branchial arch maxillary component ectoderm
not detected not detected
homogeneous
1st branchial groove ectoderm
not detected not detected
homogeneous
1st branchial membrane ectoderm
not detected not detected
homogeneous
1st branchial arch maxillary-mandibular groove ectoderm
not detected not detected
homogeneous
central nervous system
detected detected
regionalExpressed in floor plate
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Sulf2 probeA
Entity Detected:Sulf2, sulfatase 2 ( MGI:1919293)
Sequence:sense strand is shown

>Sulf2 probeA
CCAGAAATGAAGAGACCTTCTTCCAAATCACTGGGACAGCTATGGGAAGGTTGGGAAGGCTAAGCGGCCA
TAGAGAGAGGAACCTCCAAAACCAGGGGCCTCGTGTGGCTGCCCAGGCCATGCAAAAAACACCCGATTCC
CAGAAGATGAATGTTGGAACTGGGAGACCTGACAGAAGGCAGGGCCTGCTCTTGGGACAGGAAATCCTGG
AGGACAGCGCCTGGACTTTCCGATGCTCAGTTTCTTTGCCCTGCTTTGCTCTGGATCAAACCTCACTGGC
TGCTCTGGGATGCGTGCTCACACCTGGAGTCTCTGCTCACCCTTTCAGAGGCTCACAAAGACAAAGGAAC
TAATTTCCATGGACACTTCCTCCAGAGATGGAAATTGCTGGGATTCGCCCACTCCTCCCCTGCACCCCTC
CCCCAGTCATCTAGGGAAGCAAGCTTGTTTTAACCTTCTTACTCTTTGGAGAAAGCACGGACATCCCAGG
TGCTGTCAACCTCACAGTCTTGACAAAGTCTATAGCACAAAACAGTACCATTCACCAGGCTGGTTGACCT
GGCTGGCTCAGAAGCTGCCTTCACCACATACATGACCGCTCACACGTAACCAACACAGGGAATTGTAGGG
GAATCTCACTAATATGAAATCCCGCTTTTCAAGAGTCGCGGTGTCAATAAACGCTGTGGCTAGGATCAAG
GATAATCCCTTGAGCTTTCAGACATTTATTCCTGCCCGGGATTCGTTCCTTTGTTATCCATCCCAGAACT
GATGTTTTTCTAAGGTACCGAAACCCCAAGTTGATGTGTGTCCTGTGTTTTAATGACATTGTATTTGTAA
AGTTTTGTAGTATAAGTACCATCTTACAGTGTTCCTGCCCCCAGCCAATGTCTAGCTATTGGTATGAAAA
AAAAATCTTTGAATTTTTGTAAAAAAAAAAAAAAAA
nt 2658 - nt 3603 of AY101177.1
Notes:The Sulf2 probe used in this study by Ratzka et al., 2008 [PMID:18213582] was "PCR amplified from IMAGE clone 3155559 with primers Sulf2-3utr-F: 5'-CCAGAAATGAAGAGACCTTC and Sp6: CTATTTAGGTGACACTATAG.". The IMAGE clone was obtained from RZPD (Berlin). Editors Note: the Sulf2-3utr-F primer sequence is found near the 3'end of the ORF and the Sp6 primer is found in the pCMV-SPORT6 vector adjacent to the multiple cloning site. It is assumed the Sp6 primer is at the 3' end of the insert in order for PCR amplification to have worked.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:10.5 dpc
Theiler Stage:TS16
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
General Information
Authors:Ratzka A; Kalus I; Moser M; Dierks T; Mundlos S; Vortkamp A, 2008 [PMID:18213582] . Indexed and spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1002/dvdy.21423] [ PMID:18213582] Ratzka A, Kalus I, Moser M, Dierks T, Mundlos S, Vortkamp A 2008 Redundant function of the heparan sulfate 6-O-endosulfatases Sulf1 and Sulf2 during skeletal development. Dev Dyn (237):339-53
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE