Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6010

Fgf4 fibroblast growth factor 4 ( MGI:95518)
TS17 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:6010 EMAGE:6010 EMAGE:6010 EMAGE:6010
Fig3C of Mol Cell Biol 2000 20(5):1733-1746 [PMID:10669750] Kobayashi A; Yamagiwa H; Hoshino H; Muto A; Sato K; Morita M; Hayashi N; Yamamoto M; Igarashi K, "A combinatorial code for gene expression generated by transcription factor Bach2 and MAZR (MAZ-related factor) through the BTB/POZ domain." � ASM. Reproduced with permission from Molecular and Cellular Biology. Reuse of any Licensed Material requires permission from ASM. Copyright 2000. Fig3D of Mol Cell Biol 2000 20(5):1733-1746 [PMID:10669750] Kobayashi A; Yamagiwa H; Hoshino H; Muto A; Sato K; Morita M; Hayashi N; Yamamoto M; Igarashi K, "A combinatorial code for gene expression generated by transcription factor Bach2 and MAZR (MAZ-related factor) through the BTB/POZ domain." © ASM. Reproduced with permission from Molecular and Cellular Biology. Reuse of any Licensed Material requires permission from ASM. Copyright 2000. Fig3G of Mol Cell Biol 2000 20(5):1733-1746 [PMID:10669750] Kobayashi A; Yamagiwa H; Hoshino H; Muto A; Sato K; Morita M; Hayashi N; Yamamoto M; Igarashi K, "A combinatorial code for gene expression generated by transcription factor Bach2 and MAZR (MAZ-related factor) through the BTB/POZ domain." © ASM. Reproduced with permission from Molecular and Cellular Biology. Reuse of any Licensed Material requires permission from ASM. Copyright 2000. Fig3J of Mol Cell Biol 2000 20(5):1733-1746 [PMID:10669750] Kobayashi A; Yamagiwa H; Hoshino H; Muto A; Sato K; Morita M; Hayashi N; Yamamoto M; Igarashi K, "A combinatorial code for gene expression generated by transcription factor Bach2 and MAZR (MAZ-related factor) through the BTB/POZ domain." © ASM. Reproduced with permission from Molecular and Cellular Biology. Reuse of any Licensed Material requires permission from ASM. Copyright 2000.

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
C, G and J depict a sample that has been hybridised with anti-sense Fgf4 probe ( G and J are higher magnifications of the forelimb and hindlimb respectively). D has been hybridised with a sense probe (for either MAZR, Bach2 or FGF4). Image annotations: Limb buds are indicated with arrow heads in C.
Expression Pattern Description
Spatial Annotation:
EMAGE:6010Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6010_wholemount__moderate.wlz
6010_wholemount__weak.wlz
6010_wholemount__notDetected.wlz
6010_wholemount__strong.wlz
6010_wholemount__possible.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6010_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
forelimb bud apical ectodermal ridge
detected detected
Expression of FGF4 mRNA, a marker for AER, was confined to the AER.
hindlimb bud apical ectodermal ridge
detected detected
Expression of FGF4 mRNA, a marker for AER, was confined to the AER.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Fgf4 probeA
Entity Detected:Fgf4, fibroblast growth factor 4 ( MGI:95518)
Sequence:sense strand is shown

>Fgf4 probeA
ATGGCGAAACGCGGGCCGACCACAGGGACGCTGCTGCCCAGGGTCCTGCTGGCCCTGGTGGTGGCCCTGG
CGGACCGAGGGACCGCCGCACCCAACGGCACGCGGCACGCAGAATTGGGGCACGGCTGGGACGGCTTGGT
GGCCCGCTCGCTGGCACGCCTGCCGGTGGCCGCGCAGCCCCCGCAGGCGGCGGTCCGCAGCGGCGCAGGG
GACTACCTGCTGGGCCTCAAAAGGCTTCGGCGGCTCTACTGCAACGTGGGCATCGGATTCCACCTGCAGG
TGCTGCCCGACGGCCGGATCGGTGGTGTGCACGCAGACACGAGGGACAGTCTTCTGGAGCTCTCTCCGGT
GCAGCGAGGCGTGGTGAGCATCTTCGGAGTGGCCAGCCGGTTCTTCGTGGCCATGAGCAGCAGGGGCAAG
CTCTTCGGTGTGCCTTTCTTTACCGACGAGTGTAAATTCAAAGAAATACTTCTGCCCAACAACTACAACG
CCTACGAATCCTACGCGTACCCCGGTATGTTCATGGCCCTCAGTAAGAACGGGCGGACCAAGAAGGGGAA
CCGAGTGTCGCCTACCATGAAGGTAACCCACTTCCTTCCTAGACTGTGA
Notes:The Fgf4 probe used in this study by Kobayashi et al., 2000 [PMID:10669750] is described as "full-length cDNA; a kind gift from G. Martin (Hebert et al., 1990 [PMID:2318343] )." Editors note: The identifier for the 'full-length' Fgf4 (Fgfk) clone of Hebert et al., is given therein as M30642. M30642.1 contains only the ORF sequence and it is not clear from the manuscript if the clone also contains some 5'UTR and 3'UTR sequence.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:10.5 dpc
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Kobayashi A; Yamagiwa H; Hoshino H; Muto A; Sato K; Morita M; Hayashi N; Yamamoto M; Igarashi K, 2000 [PMID:10669750] , Indexed and Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1128/MCB.20.5.1733-1746.2000] [ PMID:10669750] Kobayashi A, Yamagiwa H, Hoshino H, Muto A, Sato K, Morita M, Hayashi N, Yamamoto M, Igarashi K 2000 A combinatorial code for gene expression generated by transcription factor Bach2 and MAZR (MAZ-related factor) through the BTB/POZ domain. Mol Cell Biol (20):1733-46
 [ doi:10.1016/0012-1606(90)90211-Z] [ PMID:2318343] H�bert JM, Basilico C, Goldfarb M, Haub O, Martin GR 1990 Isolation of cDNAs encoding four mouse FGF family members and characterization of their expression patterns during embryogenesis. Dev Biol (138):454-63
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE