Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6035

Pomt1 protein-O-mannosyltransferase 1 ( MGI:2138994)
TS14 (9.0 dpc)
in situ hybridisation

Data Images
EMAGE:6035 EMAGE:6035 EMAGE:6035
Fig 2E. Copyright: This image is from Willer T, Proc Natl Acad Sci U S A 2004 Oct 28;101(39):14126-31. [PMID:15383666] Copyright 2004 National Academy of Sciences, U.S.A. [doi:10.1073/pnas.0405899101] Fig 2D. Copyright: This image is from Willer T, Proc Natl Acad Sci U S A 2004 Oct 28;101(39):14126-31. [PMID:15383666] Copyright 2004 National Academy of Sciences, U.S.A. [doi:10.1073/pnas.0405899101] Fig 2F. Copyright: This image is from Willer T, Proc Natl Acad Sci U S A 2004 Oct 28;101(39):14126-31. [PMID:15383666] Copyright 2004 National Academy of Sciences, U.S.A. [doi:10.1073/pnas.0405899101]

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Wholemount in situ hybridizations (D and E) and representative cryosection (F) through the anterior neural tube at the level of the forelimb bud (indicated by a white line in E). Image annotations: strong expression seen in the ventral part of the neural tube (white arrowheads), in the developing eye (white arrow), and in the gut endoderm (black arrowheads)
Expression Pattern Description
Spatial Annotation:
EMAGE:6035Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6035_wholemount__moderate.wlz
6035_wholemount__notDetected.wlz
6035_wholemount__strong.wlz
6035_wholemount__possible.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6035_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
neural tube
strong strong
At E9.0, pronounced expression of Pomt1 transcripts was seen along the neural tube. In cross sections of E9.0 embryos, Pomt1 transcripts were predominantly detected in the ventral domain of the neural tube, including the region from which motoneurons emerge.
eye
strong strong
notochord
detected detected
gut
detected detected
regionalPomt1 was expressed in the gut endoderm.
nervous system
detected detected
regionalPomt1 was expressed in the floor plate.
neural tube floor plate
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Pomt1 probeA
Entity Detected:Pomt1, protein-O-mannosyltransferase 1 ( MGI:2138994)
Sequence:sense strand is shown

>Pomt1 probeA
ATGGAGAGGGTGCTCTTCCTCTACCACTACTTGCCGGCACTCACCTTCCAGATCCTGCTGCTCCCGATTG
TCCTGCAGCACGCCAGCGACCATCTGTGCAGGTCCCAGCTGCAGAGGAATGTCTTCAGTGCCCTGGTTGT
AGCATGGTATTCCTCCGCATGCCATGTGTCCAACATGCTACGCCCACTAACCTATGGGGACACGTCACTC
TCACCAGGCGAGCTCCGGGCCCTTCGCTGGAAAGACAGCTGGGATATTCTGATCCGAAAGTAATAGAGAA
CAAGAACACAGAAGACAAGCACACAGGACAAAGCCTCAAAGATGTGTTTGTCTCCCACCAACAGGAGCCT
CAGCAGGCAGGACTGCCAGGGTCCAGGAGGAACTCCAGGGACTAATTCCAATTTCACCTCAAGAGCCCTG
TCCACTGGTTCCTTGTTTGAAGCAATTGATTTCTCTTCACACAGTGAAGAATGTGCCCAGCCACAGCGTT
ACCCATGAGGCCCAACTCTGACCCAGCCAGAGTTTGAGCTGCCAGTGTAGGAACCACCAAGGCAGGAGGG
nt 2052 - nt 2611 of AY494857.1
Notes:The Pomt1 probe used in this study by Willer et al., 2004 [PMID:15383666] is described as "base pairs 2,052-2,611." Editors note: in the footnotes section, the authors refer to AY494857 as the identifier for this sequence.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:9.0 dpc
Theiler Stage:TS14
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase + BMpurple
General Information
Authors:Willer T; Prados B; Falcon-Perez JM; Renner-Muller I; Przemeck GK; Lommel M; Coloma A; Valero MC; de Angelis MH; Tanner W; Wolf E; Strahl S; Cruces J, 2004 [PMID:15383666] , Indexed and Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1073/pnas.0405899101] [ PMID:15383666] Willer T, Prados B, Falcon-Perez JM, Renner-Muller I, Przemeck GK, Lommel M, Coloma A, Valero MC, de Angelis MH, Tanner W, Wolf E, Strahl S, Cruces J 2004 Targeted disruption of the Walker-Warburg syndrome gene Pomt1 in mouse results in embryonic lethality. Proc Natl Acad Sci U S A (2004):14126-31
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE