Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6099

Sdc4 syndecan 4 ( MGI:1349164)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6099 EMAGE:6099 EMAGE:6099 EMAGE:6099 EMAGE:6099
"Pseudo-wholemount" of euxassay_007889. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007889_01 euxassay_007889_02 euxassay_007889_03 euxassay_007889_04
EMAGE:6099 EMAGE:6099 EMAGE:6099 EMAGE:6099 EMAGE:6099
euxassay_007889_05 euxassay_007889_06 euxassay_007889_07 euxassay_007889_08 euxassay_007889_09
EMAGE:6099 EMAGE:6099 EMAGE:6099 EMAGE:6099 EMAGE:6099
euxassay_007889_10 euxassay_007889_11 euxassay_007889_12 euxassay_007889_13 euxassay_007889_14
EMAGE:6099 EMAGE:6099 EMAGE:6099 EMAGE:6099 EMAGE:6099
euxassay_007889_15 euxassay_007889_16 euxassay_007889_17 euxassay_007889_18 euxassay_007889_19
EMAGE:6099 EMAGE:6099 EMAGE:6099
euxassay_007889_20 euxassay_007889_21 euxassay_007889_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6099Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6099_wholemount_strong.wlz
6099_wholemount_moderate.wlz
6099_wholemount_weak.wlz
6099_wholemount_possible.wlz
6099_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6099_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 13 14 15 16 17 18 moderate expression: see section 19 20 weak expression: see section 21
cervical intervertebral disc
moderate moderate
regionalmoderate expression: see section 12 13 14
lumbar intervertebral disc
moderate moderate
regionalmoderate expression: see section 11 12 13 14
thoracic intervertebral disc
moderate moderate
regionalmoderate expression: see section 11 12 13 14
humerus
strong strong
regionalstrong expression: see section 03 04 05 19 20 weak expression: see section 21
hindlimb digit 1 metatarsal
weak weak
regionalweak expression: see section 19
hindlimb digit 2 metatarsal
weak weak
regionalweak expression: see section 03 19 20
hindlimb digit 3 metatarsal
weak weak
regionalweak expression: see section 03 20
hindlimb digit 4 metatarsal
weak weak
regionalweak expression: see section 03 20
hindlimb digit 5 metatarsal
weak weak
regionalweak expression: see section 03 19
tarsus
weak weak
regionalweak expression: see section 02 03 19 20
hip
moderate moderate
regionalmoderate expression: see section 08 15 weak expression: see section 16
femur
moderate moderate
regionalmoderate expression: see section 01 05 07 16 weak expression: see section 06 17
submandibular gland primordium
strong strong
regionalstrong expression: see section 06 07 08 09 15 16 17 18
pancreas
moderate moderate
regionalmoderate expression: see section 08 09 10 14 15
thyroid gland
strong strong
regionalstrong expression: see section 10 11 moderate expression: see section 14 15
vibrissa
strong strong
regionalstrong expression: see section 05 18 19 20 moderate expression: see section 02 03 04 weak expression: see section 21
otic capsule
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 15 16 17 18
cornea epithelium
weak weak
regionalweak expression: see section 01 02 03 20 21
nasal septum
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14
esophagus
moderate moderate
regionalmoderate expression: see section 12 13 14
stomach
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10
hindgut
moderate moderate
regionalmoderate expression: see section 11 12 13
rectum
strong strong
regionalstrong expression: see section 11
midgut
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
bladder
strong strong
regionalExpression in the fundus region.
kidney calyx
strong strong
regionalstrong expression: see section 18 moderate expression: see section 07 09 weak expression: see section 06 15
kidney pelvis
strong strong
regionalstrong expression: see section 17 moderate expression: see section 08 weak expression: see section 16
urethra of male
strong strong
regionalstrong expression: see section 11 12
lung
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 moderate expression: see section 21
trachea
moderate moderate
regionalmoderate expression: see section 13
sacral vertebral cartilage condensation
moderate moderate
regionalmoderate expression: see section 11 12 13 not examined expression: see section 14
exoccipital bone
strong strong
regionalstrong expression: see section 05 06 07 moderate expression: see section 01 02 03 04 18 19 20 weak expression: see section 21
temporal bone petrous part
strong strong
regionalstrong expression: see section 05 06 moderate expression: see section 01 02 03 04 19 20 weak expression: see section 21 22
orbito-sphenoid
strong strong
regionalstrong expression: see section 05 06 07 17 moderate expression: see section 01 02 03 04 18 19 weak expression: see section 20 21 22
viscerocranium
strong strong
regionalExpression in the turbinate bone.
clavicle
strong strong
regionalstrong expression: see section 09 15 moderate expression: see section 10 weak expression: see section 16
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1360
Entity Detected:Sdc4, syndecan 4 ( MGI:1349164)
Sequence:sense strand is shown

>T1360
CCTCGAGNCTGTTGGCCTACTGGACTGGTTTGCGCTGTTGAAGCCATGGCGCCTGCCTGCCTGCTTGCGC
CGCTGCTGCTGCTGCTCCTCGGAGGCTTCCCCTTGGTCCCCGGAGAGTCGATTCGAGAGACAGAGGTCAT
CGACCCCCAGGACCTCCTGGAAGGCAGATACTTCTCTGGAGCCCTCCCCGACGACGAAGATGCTGGCGGC
TCGGATGACTTTGAGCTCTCGGGTTCTGGAGATCTGGATGACACGGAGGAGCCCAGGCCCTTCCCTGAAG
TGATTGAGCCCTTGGTGCCACTGGATAACCACATCCCTGAGAATGCACAGCCTGGCATCCGTGTCCCCTC
AGAGCCCAAGGAACTGGAAGAGAATGAGGTCATTCCTAAAAGGGCCCCCTCCGACGTGGGGGATGACATG
TCCAACAAAGTATCCATGTCCAGCACTGCCCAGGGCAGCAACATCTTTGAGAGAACTGAGGTCTTGGCAG
CTCTGATCGTGGGCGGCGTGGTAGGCATCCTCTTTGCCGTTTTCCTGATCCTGCTGCTGGTGTACCGCAT
G
Notes:The probe template was PCR amplified from IMAGE:2317560 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2317560 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14010 same embryo
 EMAGE:14007 same embryo
 EMAGE:14008 same embryo
 EMAGE:14009 same embryo
 EurExpress:euxassay_007889 same experiment
 MGI:4827920 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS