Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6207

Atp2b2 ATPase, Ca++ transporting, plasma membrane 2 ( MGI:105368)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6207 EMAGE:6207 EMAGE:6207 EMAGE:6207 EMAGE:6207
"Pseudo-wholemount" of euxassay_012931. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012931_01 euxassay_012931_02 euxassay_012931_03 euxassay_012931_04
EMAGE:6207 EMAGE:6207 EMAGE:6207 EMAGE:6207 EMAGE:6207
euxassay_012931_05 euxassay_012931_06 euxassay_012931_07 euxassay_012931_08 euxassay_012931_09
EMAGE:6207 EMAGE:6207 EMAGE:6207 EMAGE:6207 EMAGE:6207
euxassay_012931_10 euxassay_012931_11 euxassay_012931_12 euxassay_012931_13 euxassay_012931_14
EMAGE:6207 EMAGE:6207 EMAGE:6207 EMAGE:6207 EMAGE:6207
euxassay_012931_15 euxassay_012931_16 euxassay_012931_17 euxassay_012931_18 euxassay_012931_19
EMAGE:6207 EMAGE:6207 EMAGE:6207
euxassay_012931_20 euxassay_012931_21 euxassay_012931_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6207Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6207_wholemount_strong.wlz
6207_wholemount_moderate.wlz
6207_wholemount_weak.wlz
6207_wholemount_possible.wlz
6207_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6207_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 17 weak expression: see section 10 11 12 13 14 15 16
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 moderate expression: see section 20 21
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 07 08 moderate expression: see section 18 19
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 17 18 moderate expression: see section 19 20 21 22
vagus x ganglion
strong strong
regionalstrong expression: see section 08 moderate expression: see section 18 19
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 05 07 moderate expression: see section 18 19
ventral grey horn
strong strong
regionalstrong expression: see section 10 11 13 15 moderate expression: see section 12 14
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 08 09 10 14 15 16 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38476
Entity Detected:Atp2b2, ATPase, Ca++ transporting, plasma membrane 2 ( MGI:105368)
Sequence:sense strand is shown

>T38476
TCTCACTGGCCTATTCTGTGAAGAAAATGATGAAGGACAACAACCTGGTACGCCACCTGGATGCCTGTGA
GACCATGGGCAATGCCACAGCCATCTGCTCAGACAAGACAGGAACGCTGACCACCAACCGCATGACCGTG
GTCCAGGCCTATGTCGGTGACGTCCACTACAAGGAGATCCCCGATCCCAGCTCCATCAATGCCAAGACGC
TGGAGCTGCTGGTCAACGCCATTGCCATCAACAGCGCCTACACCACCAAGATCCTTCCCCCAGAAAAAGA
GGGAGCCCTGCCCCGGCAGGTGGGCAACAAGACAGAGTGCGGCCTGCTGGGCTTTGTGCTGGACTTGAGG
CAGGACTACGAGCCGGTGCGCAGCCAGATGCCAGAGGAGAAGCTGTATAAGGTGTACACCTTCAACTCCG
TGCGCAAGTCCATGAGCACCGTCATCAAGATGCCCGACGAGAGCTTCCGCATGTACAGCAAGGGCGCCTC
GGAGATTGTGCTCAAAAAGTGCTGCAAGATCCTCAGTGGGGCAGGGGAAGCCCGTGTCTTCCGGCCCCGA
GACAGGGATGAGATGGTTAAGAAGGTGATCGAGCCCATGGCCTGTGACGGGCTCCGTACCATCTGCGTGG
CCTATCGTGACTTCCCCAGCAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 150681. Forward Primer - name:150681_F_cDNA_Atp2b2, sequence:TCTCACTGGCCTATTCTGTGAA; Reverse Primer - name:150681_N_SP6_cDNA_Atp2b2, sequence:CTGCTGGGGAAGTCACGATAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6208 same embryo
 EMAGE:6210 same embryo
 EMAGE:6209 same embryo
 EurExpress:euxassay_012931 same experiment
 MGI:4823310 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS