Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6238

Shisa6 shisa homolog 6 (Xenopus laevis) ( MGI:2685725)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6238 EMAGE:6238 EMAGE:6238 EMAGE:6238 EMAGE:6238
"Pseudo-wholemount" of euxassay_016089. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_016089_01 euxassay_016089_02 euxassay_016089_03 euxassay_016089_04
EMAGE:6238 EMAGE:6238 EMAGE:6238 EMAGE:6238 EMAGE:6238
euxassay_016089_05 euxassay_016089_06 euxassay_016089_07 euxassay_016089_08 euxassay_016089_09
EMAGE:6238 EMAGE:6238 EMAGE:6238 EMAGE:6238 EMAGE:6238
euxassay_016089_10 euxassay_016089_11 euxassay_016089_12 euxassay_016089_13 euxassay_016089_14
EMAGE:6238 EMAGE:6238 EMAGE:6238 EMAGE:6238 EMAGE:6238
euxassay_016089_15 euxassay_016089_16 euxassay_016089_17 euxassay_016089_18 euxassay_016089_19
EMAGE:6238 EMAGE:6238 EMAGE:6238 EMAGE:6238
euxassay_016089_20 euxassay_016089_21 euxassay_016089_22 euxassay_016089_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6238Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6238_wholemount_strong.wlz
6238_wholemount_moderate.wlz
6238_wholemount_weak.wlz
6238_wholemount_possible.wlz
6238_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6238_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
cerebral cortex mantle layer
weak weak
regionalweak expression: see section 05 06 07
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 12 weak expression: see section 09 18 19
pons mantle layer
moderate moderate
regionalmoderate expression: see section 08 weak expression: see section 16 17 18
metencephalon roof
weak weak
regionalweak expression: see section 13 14
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 weak expression: see section 20
spinal cord floor plate
weak weak
regionalweak expression: see section 11 13 14 16
spinal cord roof plate
weak weak
regionalweak expression: see section 11 12 13 14 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39803
Entity Detected:Shisa6, shisa homolog 6 (Xenopus laevis) ( MGI:2685725)
Sequence:sense strand is shown

>T39803
ACCTGCTACTATCGCTTCTGCTGCAAGAAGCGCCACGAGAAGCTGGACCAGCGCCAGTGCACCAACTACC
AAAGCCCCGTATGGGTGCAGACGCCCAGCACCAAGGTAGTGTCGCCGGGGCCCGAGAACAAGTACGACCC
GGAGAAGGACAAGACCAACTTCACCGTCTACATCACTTGCGGGGTGATCGCCTTCGTCATCGTGGCGGGC
GTCTTCGCCAAGGTCTCCTATGACAAGGCCCACCGCCCTCCGCGAGAGATGAACATCCACAGGGCTCTGG
CTGACATTCTAAGACAACAGGGACCAATCCCCATAGCACACTGTGAAAGAGAAACCATCTCGGCCATCGA
TACCTCTCCCAAAGAGAACACGCCGGTCCGATCAACCTCCAAAAACCACTACACCCCTGTGCGCACAGCC
AAGCAGACTCCAGGGCATTATGGGAAGGATGCTTACCGAAGTGGAGGACCAGATCTCCATAACTTCATCT
CATCTGGATTTGTCACATTAGGAAGAGGACACACGAAGGGTGATCGTCAGTATAATCATCCGATCTTAAG
CAGCGCTACCCAGACCCCTACACATGAGAAGCCACGGATGAATAACATTCTGACGTCGGCCACGGAACCC
TATGACCTCTCCTTCTCA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 87421. Forward Primer - name:087421_F_cDNA_LOC380702, sequence:ACCTGCTACTATCGCTTCTGCT; Reverse Primer - name:087421_N_SP6_cDNA_LOC380702, sequence:TGAGAAGGAGAGGTCATAGGGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6237 same embryo
 EMAGE:6241 same embryo
 EMAGE:6239 same embryo
 EMAGE:6236 same embryo
 EMAGE:6240 same embryo
 EurExpress:euxassay_016089 same experiment
 MGI:4828059 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS