Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6264

4732419C18Rik RIKEN cDNA 4732419C18 gene ( MGI:3045379)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6264 EMAGE:6264 EMAGE:6264 EMAGE:6264 EMAGE:6264
"Pseudo-wholemount" of euxassay_016115. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_016115_01 euxassay_016115_02 euxassay_016115_03 euxassay_016115_04
EMAGE:6264 EMAGE:6264 EMAGE:6264 EMAGE:6264 EMAGE:6264
euxassay_016115_05 euxassay_016115_06 euxassay_016115_07 euxassay_016115_08 euxassay_016115_09
EMAGE:6264 EMAGE:6264 EMAGE:6264 EMAGE:6264 EMAGE:6264
euxassay_016115_10 euxassay_016115_11 euxassay_016115_12 euxassay_016115_13 euxassay_016115_14
EMAGE:6264 EMAGE:6264 EMAGE:6264 EMAGE:6264 EMAGE:6264
euxassay_016115_15 euxassay_016115_16 euxassay_016115_17 euxassay_016115_18 euxassay_016115_19

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6264Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6264_wholemount_strong.wlz
6264_wholemount_moderate.wlz
6264_wholemount_weak.wlz
6264_wholemount_possible.wlz
6264_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6264_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
cerebral cortex mantle layer
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 09 10 11 12 17 18 19
telencephalon mantle layer
weak weak
regionalweak expression: see section 04 08 09
olfactory cortex mantle layer
weak weak
regionalweak expression: see section 07 08 12
pons mantle layer
moderate moderate
regionalmoderate expression: see section 09 weak expression: see section 08 14 15
facial vii ganglion
strong strong
single cellstrong expression: see section 03 moderate expression: see section 04 05 weak expression: see section 18
glossopharyngeal ix ganglion
moderate moderate
single cellmoderate expression: see section 06 weak expression: see section 16
trigeminal v ganglion
strong strong
single cellstrong expression: see section 02 03 moderate expression: see section 04 05 06 weak expression: see section 15 16 17 18 19
vagus x ganglion
moderate moderate
single cellmoderate expression: see section 07
vestibulocochlear viii ganglion
moderate moderate
single cellmoderate expression: see section 05
ventral grey horn
moderate moderate
regionalmoderate expression: see section 09 10 14 weak expression: see section 11 12 13
dorsal root ganglion
moderate moderate
single cellmoderate expression: see section 07 08 09 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T40065
Entity Detected:4732419C18Rik, RIKEN cDNA 4732419C18 gene ( MGI:3045379)
Sequence:sense strand is shown

>T40065
GAACAGGGAAGAAAATAGGGCTGGGCTTCCTCCCATCCAGGGAAGAGAGGAGAGAGGGAGGGAGGGAGAG
AGAGAGAGAGAGGACGAGGAGGAGGTGGGGATTTGCCACCAGGGGAGAGTCTGGAAGATGCCATGGAAAA
ACACCTGGAGCAAAGAAAGCCATGAAATGCTATTATTTCAGGGATTTTTGGCTGGGAGGTAGCTAGCTTA
GTGTAGAGGATTAAAATAAAGTAATACTGCTTAGTTGTTGTGCCCTTAAAGCTTGATACATAAATGTATT
AGTCCAGTCTCAATTATTTGGGAGCTAGCTGGGTGAAAGAAAACTGCAAAACGCTTATTAAAACGCCATT
AACATCGGCTCTCAGAGGGTGGAGGCGACCTTCATGGTCTGACTGTGGAAAGAAAGAATGACAGCCACCT
TCAGATTCAAAGCCTTTCTGGAGACCTGCAGCAGGCGGGTGCCAGCTCTAGCCACGGAAGGGGAGCCACC
AAGATTAGGACGCACGGCAAGGTTGGCTTTACTTTGGAAGTTGTCAAAGGGGATGAACGGTAAAATAGTC
TGGACAGAGGCTAAGTGTTCTATAAAATACTCTTAATTTTAAGAGGAGCCGAAGCTAGAGTTAAAATGGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 81633. Forward Primer - name:081633_F_cDNA_LOC434357, sequence:GAACAGGGAAGAAAATAGGGCT; Reverse Primer - name:081633_N_SP6_cDNA_LOC434357, sequence:TCCATTTTAACTCTAGCTTCGGC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6261 same embryo
 EMAGE:6263 same embryo
 EMAGE:6260 same embryo
 EMAGE:6265 same embryo
 EMAGE:6266 same embryo
 EMAGE:6262 same embryo
 EurExpress:euxassay_016115 same experiment
 MGI:4822710 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS