Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6267

5830411J07Rik RIKEN cDNA 5830411J07 gene ( MGI:1921992)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6267 EMAGE:6267 EMAGE:6267 EMAGE:6267 EMAGE:6267
"Pseudo-wholemount" of euxassay_016118. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_016118_01 euxassay_016118_02 euxassay_016118_03 euxassay_016118_04
EMAGE:6267 EMAGE:6267 EMAGE:6267 EMAGE:6267 EMAGE:6267
euxassay_016118_05 euxassay_016118_06 euxassay_016118_07 euxassay_016118_08 euxassay_016118_09
EMAGE:6267 EMAGE:6267 EMAGE:6267 EMAGE:6267 EMAGE:6267
euxassay_016118_10 euxassay_016118_11 euxassay_016118_12 euxassay_016118_13 euxassay_016118_14
EMAGE:6267 EMAGE:6267 EMAGE:6267 EMAGE:6267 EMAGE:6267
euxassay_016118_15 euxassay_016118_16 euxassay_016118_17 euxassay_016118_18 euxassay_016118_19
EMAGE:6267 EMAGE:6267 EMAGE:6267
euxassay_016118_20 euxassay_016118_21 euxassay_016118_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6267Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6267_wholemount_strong.wlz
6267_wholemount_moderate.wlz
6267_wholemount_weak.wlz
6267_wholemount_possible.wlz
6267_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6267_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 11 12 13 14 15 16 17 18 19 20 21
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 10 11 12 13 14 15 16 17 18 19 20 21 22
medulla oblongata
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16
metencephalon
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17
facial vii ganglion
moderate moderate
single cellmoderate expression: see section 03 04 05 18 19
glossopharyngeal ix ganglion
moderate moderate
single cellmoderate expression: see section 05 06 16 17
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 02 03 04 05 06 07 16 17 18 19 20 21
vagus x ganglion
moderate moderate
single cellmoderate expression: see section 07 15
vestibulocochlear viii ganglion
moderate moderate
single cellmoderate expression: see section 06 16 17
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14
dorsal root ganglion
strong strong
single cellstrong expression: see section 05 06 07 08 09 14 15 moderate expression: see section 13
neural retina
moderate moderate
regionalmoderate expression: see section 22 weak expression: see section 01 02 03
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T40302
Entity Detected:5830411J07Rik, RIKEN cDNA 5830411J07 gene ( MGI:1921992)
Sequence:sense strand is shown

>T40302
AGGAGCTCAGAAGAGGGTCTTTGGATCCCCTGGAACTGGTATGGAACAGAAGGTTGTAAGTTGCCATGTG
AATGCCCTACAAGAGCAGCAAGGATACAGGGAGCCATATCTTGAGCCCTGGGTGAACTTCTTTTAAGCAA
ATTAAACTTTGAAAGAGGTTAAAGATGTGCCATACTTGTCTGTAAGTTATCTGGAAGATTAAAGGTGTGT
GCTAATCTTCAGGAATTTTTTTTTATTAGATGTTTTCTTTATTTACATTGCAAATTTTATCCCCTTTCCT
CATCCCCCCTCAGAAAAACCCCCTATCCCATCCCCTCTCCCCCTGTTCACTAACCCACCCACTCCTGCTT
CCCTGCCCTGGCATTCCCCTACATTTGGGCATGGAGTCTTCACAAGACCAACGGCCTCTCCTCTCATTGA
TGTCCCTCAAGGCCATCCTCTGCTACATATTCGGCTGGAGACATGAGTTCCTCCATGTGTACCCTTTGGT
TGGTTTAGTCCCTGGGAGCTCTGGGGGGTACTGGTTGGTTCATATAGTTGTTCCTCCTATAGGGCTGCAA
ACTCCTTCAGCTTCTTGTGTCCTTTCTTTAGCTCCTCCACTGTGGAACCTGTGCTCAGTTCAATGGATGG
CTGTGAGCCTCCATTTCTGTATTTGCCAGGTACTGGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 65900. Forward Primer - name:065900_F_cDNA_5830411J07Rik, sequence:AGGAGCTCAGAAGAGGGTCTTT; Reverse Primer - name:065900_N_SP6_cDNA_5830411J07Rik, sequence:GCCAGTACCTGGCAAATACAGA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6268 same embryo
 EMAGE:6272 same embryo
 EMAGE:6270 same embryo
 EMAGE:6269 same embryo
 EMAGE:6271 same embryo
 EurExpress:euxassay_016118 same experiment
 MGI:4822772 same experiment
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS