Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6294

AU021063 expressed sequence AU021063 ( MGI:2146136)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6294 EMAGE:6294 EMAGE:6294 EMAGE:6294 EMAGE:6294
"Pseudo-wholemount" of euxassay_016185. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_016185_01 euxassay_016185_02 euxassay_016185_03 euxassay_016185_04
EMAGE:6294 EMAGE:6294 EMAGE:6294 EMAGE:6294 EMAGE:6294
euxassay_016185_05 euxassay_016185_06 euxassay_016185_07 euxassay_016185_08 euxassay_016185_09
EMAGE:6294 EMAGE:6294 EMAGE:6294 EMAGE:6294 EMAGE:6294
euxassay_016185_10 euxassay_016185_11 euxassay_016185_12 euxassay_016185_13 euxassay_016185_14
EMAGE:6294 EMAGE:6294 EMAGE:6294 EMAGE:6294 EMAGE:6294
euxassay_016185_15 euxassay_016185_16 euxassay_016185_17 euxassay_016185_18 euxassay_016185_19
EMAGE:6294 EMAGE:6294 EMAGE:6294 EMAGE:6294 EMAGE:6294
euxassay_016185_20 euxassay_016185_21 euxassay_016185_22 euxassay_016185_23 euxassay_016185_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6294Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6294_wholemount_strong.wlz
6294_wholemount_moderate.wlz
6294_wholemount_weak.wlz
6294_wholemount_possible.wlz
6294_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6294_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon
moderate moderate
regionalmoderate expression: see section 08 13 17 weak expression: see section 09 10 11 12 14 15 18
telencephalon
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 21 22 23 24 weak expression: see section 09 10 11 12 13 14 15 17 18 19 20
medulla oblongata
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 17 weak expression: see section 14 15 18 19 20
metencephalon
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 17 21 22 23 weak expression: see section 15 16 18 19 20
midbrain
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 17 21 weak expression: see section 15 16 18 19 20
facial vii ganglion
moderate moderate
single cellmoderate expression: see section 06 21
glossopharyngeal ix ganglion
weak weak
single cellweak expression: see section 08 19
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 04 05 06 07 17 18 21 22 weak expression: see section 08 09 19 20
vagus x ganglion
weak weak
single cellweak expression: see section 09
spinal cord
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17
dorsal root ganglion
moderate moderate
single cellmoderate expression: see section 09 10 11 12 13 14 17 18 19 20
neural retina
weak weak
regionalweak expression: see section 01 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39817
Entity Detected:AU021063, expressed sequence AU021063 ( MGI:2146136)
Sequence:sense strand is shown

>T39817
ACAAGACACCTGCTTCGACATAAGTTGCAGACGAAGTATAGATTTCTCAGGAGCAGATCCACAGGGGATT
TGCTAAGAGGCATGAGGAGTGTGAACTCAGTTACCAGCTCACTACAGATCCTCCTGGAGGAACAAATGCT
GTATGGGATCCCAAAATATGGCAAGGTTTCCAGGTGGCGCCGAGCACCAGACGGCTTTGAGTCTGGAGAT
AGTTCCACCACAAGGCTCACGACCAGCAGAGGGTGCCACCATCCCACAGGGAGGCACCCAGGACTCTCCA
ATCCTCCCTGGAGAAACTGTGGAACCGCAGAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 88106. Forward Primer - name:088106_F_cDNA_A330009N23Rik, sequence:ACAAGACACCTGCTTCGACATA; Reverse Primer - name:088106_N_SP6_cDNA_A330009N23Rik, sequence:CTCTGCGGTTCCACAGTTTCT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6293 same assay
 EMAGE:6289 same embryo
 EMAGE:6295 same embryo
 EMAGE:6292 same embryo
 EMAGE:6290 same embryo
 EurExpress:euxassay_016185 same experiment
 MGI:4823352 same experiment
 MGI:4823351 same experiment
 EMAGE:6291 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS