Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6306

Il13ra1 interleukin 13 receptor, alpha 1 ( MGI:105052)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6306 EMAGE:6306 EMAGE:6306 EMAGE:6306 EMAGE:6306
"Pseudo-wholemount" of euxassay_007297. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007297_01 euxassay_007297_02 euxassay_007297_03 euxassay_007297_04
EMAGE:6306 EMAGE:6306 EMAGE:6306 EMAGE:6306 EMAGE:6306
euxassay_007297_05 euxassay_007297_06 euxassay_007297_07 euxassay_007297_08 euxassay_007297_09
EMAGE:6306 EMAGE:6306 EMAGE:6306 EMAGE:6306 EMAGE:6306
euxassay_007297_10 euxassay_007297_11 euxassay_007297_12 euxassay_007297_13 euxassay_007297_14
EMAGE:6306 EMAGE:6306 EMAGE:6306 EMAGE:6306 EMAGE:6306
euxassay_007297_15 euxassay_007297_16 euxassay_007297_17 euxassay_007297_18 euxassay_007297_19
EMAGE:6306 EMAGE:6306 EMAGE:6306 EMAGE:6306 EMAGE:6306
euxassay_007297_20 euxassay_007297_21 euxassay_007297_22 euxassay_007297_23 euxassay_007297_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6306Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6306_wholemount_strong.wlz
6306_wholemount_moderate.wlz
6306_wholemount_weak.wlz
6306_wholemount_possible.wlz
6306_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6306_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
pituitary gland
strong strong
spottedstrong expression: see section 11 12 13 14 15 16
aorta
strong strong
regionalstrong expression: see section 11 12 13 14
stomach mesentery
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07
midgut
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
metanephros
moderate moderate
regionalmoderate expression: see section 07 08 09 10 16 17 18 19
left lung
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 moderate expression: see section 04 05 06
right lung
strong strong
regionalstrong expression: see section 13 14 15 16 17 18 19 moderate expression: see section 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2070
Entity Detected:Il13ra1, interleukin 13 receptor, alpha 1 ( MGI:105052)
Sequence:sense strand is shown

>T2070
TGGCCTCGAGNCAGATTCGGCACGAGGGCTTAAGATCATTATATTTCCTCCAATTCCTGATCCTGGCAAG
ATTTTTAAAGAAATGTTTGGAGACCAGAATGATGATACCCTGCACTGGAAGAAGTATGACATCTATGAGA
AACAATCCAAAGAAGAAACGGATTCTGTAGTGCTGATAGAAAACCTGAAGAAAGCAGCTCCTTGATGGGG
AGAAGTGATTTCTTTCTTGCCTTCAATGTGACCCTGTGAAGATTTATTGCATTCTCCATTTGTTATCTGG
GGACTTGTTAAATAGAAACTGAAACTACTCTTGAAAAACAGGCAGCTCCTAAGAGCCACAGGTCTTGATG
TGACTTTTGCATTGAAAATCCAAACCAAAGGAGCTCTTCAAGAAAAGCAGAGTTCTTCTCGTTCTTGTTC
AATCCTAAAAGCAGATGTTTTGCCAAATCTCCAAACTAGAGGACAAAGACAAGGGGACAATGACCATCAA
TTCATCTAATCAGGAATTGTGATGGCTTCCTAAGGAATCTCTGCTTGCTCTGTATTCTTTATGTGGAATA
Notes:The probe template was PCR amplified from IMAGE:821245 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:821245 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6309 same embryo
 EMAGE:6308 same embryo
 EMAGE:6307 same embryo
 EurExpress:euxassay_007297 same experiment
 MGI:4825562 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS