Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6386

2310065F04Rik RIKEN cDNA 2310065F04 gene ( MGI:1921434)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6386 EMAGE:6386 EMAGE:6386 EMAGE:6386 EMAGE:6386
"Pseudo-wholemount" of euxassay_016255. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_016255_01 euxassay_016255_02 euxassay_016255_03 euxassay_016255_04
EMAGE:6386 EMAGE:6386 EMAGE:6386 EMAGE:6386 EMAGE:6386
euxassay_016255_05 euxassay_016255_06 euxassay_016255_07 euxassay_016255_08 euxassay_016255_09
EMAGE:6386 EMAGE:6386 EMAGE:6386 EMAGE:6386 EMAGE:6386
euxassay_016255_10 euxassay_016255_11 euxassay_016255_12 euxassay_016255_13 euxassay_016255_14
EMAGE:6386 EMAGE:6386 EMAGE:6386 EMAGE:6386 EMAGE:6386
euxassay_016255_15 euxassay_016255_16 euxassay_016255_17 euxassay_016255_18 euxassay_016255_19
EMAGE:6386 EMAGE:6386 EMAGE:6386 EMAGE:6386
euxassay_016255_20 euxassay_016255_21 euxassay_016255_22 euxassay_016255_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6386Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6386_wholemount_strong.wlz
6386_wholemount_moderate.wlz
6386_wholemount_weak.wlz
6386_wholemount_possible.wlz
6386_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6386_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 09 10 15 16
pons mantle layer
weak weak
regionalweak expression: see section 08 16
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 19
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 17 weak expression: see section 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 15 16 17 19 weak expression: see section 18 20
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 08 16
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 07 17
ventral grey horn
moderate moderate
single cellmoderate expression: see section 10 11 12 13 14 15
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18
neural retina
moderate moderate
regionalmoderate expression: see section 01 weak expression: see section 20 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T45603
Entity Detected:2310065F04Rik, RIKEN cDNA 2310065F04 gene ( MGI:1921434)
Sequence:sense strand is shown

>T45603
CAGGAAGCTTTGAGGTTTGAGTCCGCTTGGCAGGGAGGAGGCGTCACTCAGGGAGCATGGACTGTGTTCT
GGGGATTTGAGATTGGGGGACTGTTCTCAAGAGAGACCTGGGGTTGTGCTCAGCCTTGCCCAATGCTTGG
GTCACTCTAGTCTGGAATGGTCACAGAAGTGCAGTCTCTGTCGGAGAAACCAAACCCTTTGTAGGACCTG
TCTTGAACTAAGGAAAGAATGGTAGGTGGAACAGAGCTCAACGGACACCGAGAGCATCTCCCAAGCGACA
AGACCCCCCCCCCCGGCCCCCGTTAGTGAGCGTGAGATGTTCGTGGGCAAAGACACGGGAATGGGTTCTC
AAGCAGAGGGGATGCACTTTATGATCCATCTGCCATGTTTGCAGGTGAGTGAGTGAGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from genomic DNA prepared from tail-tips of two wild-type C57BL/6J mice), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 209187. Forward Primer - name:209187_F_exon_2310065F04Rik, sequence:CAGGAAGCTTTGAGGTTTGAGT; Reverse Primer - name:209187_N_SP6_exon_2310065F04Rik, sequence:CCTCACTCACTCACCTGCAAA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6388 same embryo
 EMAGE:6387 same embryo
 EMAGE:6384 same embryo
 EMAGE:6385 same embryo
 EMAGE:6389 same embryo
 EurExpress:euxassay_016255 same experiment
 MGI:4822669 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS