Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6388

Ccdc88c coiled-coil domain containing 88C ( MGI:1915589)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6388 EMAGE:6388 EMAGE:6388 EMAGE:6388 EMAGE:6388
"Pseudo-wholemount" of euxassay_016252. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_016252_01 euxassay_016252_02 euxassay_016252_03 euxassay_016252_04
EMAGE:6388 EMAGE:6388 EMAGE:6388 EMAGE:6388 EMAGE:6388
euxassay_016252_05 euxassay_016252_06 euxassay_016252_07 euxassay_016252_08 euxassay_016252_09
EMAGE:6388 EMAGE:6388 EMAGE:6388 EMAGE:6388 EMAGE:6388
euxassay_016252_10 euxassay_016252_11 euxassay_016252_12 euxassay_016252_13 euxassay_016252_14
EMAGE:6388 EMAGE:6388 EMAGE:6388 EMAGE:6388 EMAGE:6388
euxassay_016252_15 euxassay_016252_16 euxassay_016252_17 euxassay_016252_18 euxassay_016252_19
EMAGE:6388 EMAGE:6388 EMAGE:6388 EMAGE:6388 EMAGE:6388
euxassay_016252_20 euxassay_016252_21 euxassay_016252_22 euxassay_016252_23 euxassay_016252_24
EMAGE:6388 EMAGE:6388
euxassay_016252_25 euxassay_016252_26

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6388Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6388_wholemount_strong.wlz
6388_wholemount_moderate.wlz
6388_wholemount_weak.wlz
6388_wholemount_possible.wlz
6388_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6388_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 21 22 23 24 25
humerus
weak weak
regionalweak expression: see section 02 03 25 26
femur
weak weak
regionalweak expression: see section 03 04 21 22
cerebral cortex mantle layer
weak weak
regionalweak expression: see section 07 08 09 10 11 15 16 17 18 19 20 21
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 10 11 17 18
rest of cerebellum mantle layer
weak weak
regionalweak expression: see section 12 13 14 16 17 18
pons mantle layer
weak weak
regionalweak expression: see section 08 09 19 20
midbrain mantle layer
weak weak
regionalweak expression: see section 09 20 21
ventral grey horn
weak weak
regionalweak expression: see section 12 13 14 16 17
mandible
moderate moderate
regionalmoderate expression: see section 05 06 07 19 20 21 22 weak expression: see section 08 09 17 18
maxilla
weak weak
regionalweak expression: see section 08 17
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 02 03 04 21 22 23 24 25 26
clavicle
moderate moderate
regionalmoderate expression: see section 19 weak expression: see section 08 09 10 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T45530
Entity Detected:Ccdc88c, coiled-coil domain containing 88C ( MGI:1915589)
Sequence:sense strand is shown

>T45530
TAGGAAAAGCTGACAGTCCCTCTCCAGGCCAGGGTACCCGAGGCCGGCCACTGGACACAAGACGCTTCTC
TCTGGCCCCCCCAAAGGAAGAGAGGCTGGCCCCCCTACAGCAGTCTGCCACAGCCCCAGCCCTTGCTACT
GGATGTAGCAGTGGTAGCAACCCCCAGATCCAGCACTTTTCTCCTACAGTGGCTCCTGCGGTCAGGACAA
AATCCAAAGTGCCACAACACTCAGGGGAGGTAGCCACCGTAGCTCCTGTGCGTCCAGGGCTCGGCACCTC
AGAGGGAGATGGGGGCCCAGGGCATGGTTACAGCGAAGGGCTTCTGACCAAAAGCCCTGGCAGGTCTTCT
GACTTGCCTCCCCATGTCAAAAGGGGCCCCGATGACTTCAGTCAAGGGAGCAGTTCAAAGAGCACACCGG
CGTCCCCAGAGCCAGGTGGGGACCCGCAGACAGTGTGGTATGAGTACGGCTGCGTGTGACTCGCATCGTG
GATCTGCAGCTTGCAAAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from genomic DNA prepared from tail-tips of two wild-type C57BL/6J mice), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 225429. Forward Primer - name:225429_F_exon_0610010D24Rik, sequence:TAGGAAAAGCTGACAGTCCCTC; Reverse Primer - name:225429_N_SP6_exon_0610010D24Rik, sequence:ATTTGCAAGCTGCAGATCCAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6387 same embryo
 EMAGE:6386 same embryo
 EMAGE:6384 same embryo
 EMAGE:6385 same embryo
 EMAGE:6389 same embryo
 EurExpress:euxassay_016252 same experiment
 MGI:4823687 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS