EMAGE mouse gene expression spatial database

Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6465

Mir297-1 microRNA 297-1 ( MGI:3619319)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_019071. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_019071_01	euxassay_019071_02	euxassay_019071_03	euxassay_019071_04

euxassay_019071_05	euxassay_019071_06	euxassay_019071_07	euxassay_019071_08	euxassay_019071_09

euxassay_019071_10	euxassay_019071_11	euxassay_019071_12	euxassay_019071_13	euxassay_019071_14

euxassay_019071_15	euxassay_019071_16	euxassay_019071_17	euxassay_019071_18	euxassay_019071_19

euxassay_019071_20	euxassay_019071_21	euxassay_019071_22	euxassay_019071_23	euxassay_019071_24

euxassay_019071_25	euxassay_019071_26

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

	strong
	moderate
	weak
	possible
	not detected

wholemount mapping

Download individual expression domains:

6465_wholemount_strong.wlz

6465_wholemount_moderate.wlz

6465_wholemount_weak.wlz

6465_wholemount_possible.wlz

6465_wholemount_not_detected.wlz

(what is wlz format?)

Download all expression domains:

EMAGE:6465_all_domains.zip

Find spatially similar wholemount expression patterns:

EMAGE spatially similar wholemount patterns

Morphological match to the template:

Text Annotation:

Structure

Level

Pattern

Notes

diencephalon lateral wall mantle layer

moderate

single cell

moderate expression: see section 09 10 11 12 13 14 15 16 17 18 19 20 weak expression: see section 08

cerebral cortex mantle layer

moderate

single cell

moderate expression: see section 05 06 07 09 10 11 13 15 16 17 18 19 20 22 23 24 weak expression: see section 04 08 12 21

telencephalon mantle layer

moderate

single cell

moderate expression: see section 01 02 05 06 07 09 10 11 13 14 15 16 17 18 19 20 22 23 24 25 26 weak expression: see section 03 04 08 12 21

olfactory cortex mantle layer

moderate

single cell

moderate expression: see section 10 11 13 15 16 17 18 weak expression: see section 12

medulla oblongata alar plate mantle layer

moderate

single cell

moderate expression: see section 08 09 10 13 14 15 16 17 18 19 weak expression: see section 11

medulla oblongata basal plate mantle layer

moderate

single cell

moderate expression: see section 09 10 13 14 15 16 17 weak expression: see section 11 12

rest of cerebellum mantle layer

moderate

single cell

moderate expression: see section 06 08 09 10 15 16 17 18 19 20 21 22 weak expression: see section 07

pons mantle layer

moderate

single cell

moderate expression: see section 08 09 10 13 14 15 16 17 18 19 20 weak expression: see section 07 11 12

midbrain mantle layer

moderate

single cell

moderate expression: see section 09 10 11 12 13 14 15 16 17 18 19 20 21 weak expression: see section 07 08

facial vii ganglion

moderate

single cell

moderate expression: see section 05 06 21

glossopharyngeal ix ganglion

moderate

single cell

moderate expression: see section 19

trigeminal v ganglion

moderate

single cell

moderate expression: see section 04 05 06 07 08 09 18 19 20 21 22

dorsal grey horn

moderate

single cell

moderate expression: see section 10 11 12 13 14 15 16 17 18

ventral grey horn

moderate

single cell

moderate expression: see section 10 11 12 13 14 15 16 17 18

dorsal root ganglion

moderate

single cell

moderate expression: see section 09 10 11 12 13 14 15 16 17 18 19 weak expression: see section 07 08

neural retina

weak

regional

weak expression: see section 01 02 03 23 24 25

Annotation Validation:

spatial mapping by EMAGE editor, text annotation by author

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T70373
Entity Detected:	Mir297-1, microRNA 297-1 ( MGI:3619319)
Sequence:	sense strand is shown >T70373 ATGTATGTGTGCATGTGCATGT
Notes:	The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-297a was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:	LNA
Strand:	antisense
Label:	digoxigenin

Specimen

Organism:	mouse
Strain:	C57BL/6
Age:	14.5 dpc
Theiler Stage:	TS23
Mutations:	none (wild-type)
Preparation:	section

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:6463 same assay
	EurExpress:euxassay_019071 same experiment
	EMAGE:6466 same assay
	EMAGE:6467 same assay
	EMAGE:6468 same assay
	EMAGE:6469 same embryo
	EMAGE:6464 same embryo
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source