EMAGE mouse gene expression spatial database

Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6469

Mir206 microRNA 206 ( MGI:2676881)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_019032. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_019032_01	euxassay_019032_02	euxassay_019032_03	euxassay_019032_04

euxassay_019032_05	euxassay_019032_06	euxassay_019032_07	euxassay_019032_08	euxassay_019032_09

euxassay_019032_10	euxassay_019032_11	euxassay_019032_12	euxassay_019032_13	euxassay_019032_14

euxassay_019032_15	euxassay_019032_16	euxassay_019032_17	euxassay_019032_18	euxassay_019032_19

euxassay_019032_20	euxassay_019032_21	euxassay_019032_22	euxassay_019032_23	euxassay_019032_24

euxassay_019032_25	euxassay_019032_26

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

	strong
	moderate
	weak
	possible
	not detected

wholemount mapping

Download individual expression domains:

6469_wholemount_strong.wlz

6469_wholemount_moderate.wlz

6469_wholemount_weak.wlz

6469_wholemount_possible.wlz

6469_wholemount_not_detected.wlz

(what is wlz format?)

Download all expression domains:

EMAGE:6469_all_domains.zip

Find spatially similar wholemount expression patterns:

EMAGE spatially similar wholemount patterns

Morphological match to the template:

Text Annotation:

Structure

Level

Pattern

Notes

diencephalon lateral wall mantle layer

weak

single cell

weak expression: see section 09 12 16 17

cerebral cortex mantle layer

moderate

single cell

moderate expression: see section 16 20 21 24 weak expression: see section 05 06 09 10 17 22 23

telencephalon mantle layer

moderate

single cell

moderate expression: see section 20 21 24 25 weak expression: see section 05 06 22 23

olfactory cortex mantle layer

moderate

single cell

moderate expression: see section 16 weak expression: see section 09 10 14 17

rest of cerebellum mantle layer

weak

single cell

weak expression: see section 05 06 09 16 20 21

midbrain mantle layer

weak

single cell

weak expression: see section 09 11 12 16 17 18 19 20

trigeminal v ganglion

moderate

single cell

moderate expression: see section 20 21 weak expression: see section 05 06 16 17

spinal cord mantle layer

weak

single cell

weak expression: see section 09 10 12 13 16 17

dorsal root ganglion

weak

single cell

weak expression: see section 12 13

tail mesenchyme

weak

regional

weak expression: see section 16 17 18

Annotation Validation:

spatial mapping by EMAGE editor, text annotation by author

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T70328
Entity Detected:	Mir206, microRNA 206 ( MGI:2676881)
Sequence:	sense strand is shown >T70328 TGGAATGTAAGGAAGTGTGTGG
Notes:	The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-206 was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:	LNA
Strand:	antisense
Label:	digoxigenin

Specimen

Organism:	mouse
Strain:	C57BL/6
Age:	14.5 dpc
Theiler Stage:	TS23
Mutations:	none (wild-type)
Preparation:	section

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:6463 same embryo
	EMAGE:6464 same embryo
	EMAGE:6465 same embryo
	EMAGE:6466 same embryo
	EMAGE:6467 same embryo
	EMAGE:6468 same embryo
	EurExpress:euxassay_019032 same experiment
	MGI:4826245 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source