Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:649

Meox1 mesenchyme homeobox 1 ( MGI:103220)
TS15 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:649
Fig4A, Filosa et al, 1997 [PMID:9226455] . Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd who owns the copyright.

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
***NOTE*** : This embryo is a double staining for Meox1 (in the somites and branchial arch) and Otx2 (in the head). Only the Meox1 staining pattern has been annotated in this EMAGE entry.
Expression Pattern Description
Spatial Annotation:
EMAGE:649Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
649_wholemount_strong_3D_1.wlz
649_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:649_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
2nd branchial arch
detected detected
Authors state expression detected in the 2nd, 3rd and 4th archs
3rd branchial arch
detected detected
Authors state expression detected in the 2nd, 3rd and 4th archs
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1101195
Entity Detected:Meox1, mesenchyme homeobox 1 ( MGI:103220)
Sequence:sense strand is shown

>MGI:1101195
AGATAAGGACAGGAAAACAACCCATCTTCCTCCATGGGATGCATTTGGACCTATCCTGCGTGTTCCGGAA
AAAGCTTTGTGGGAAGACCTCCCAGGTTCACACACATGCGCAGCTCAGATCTCAGACCCAACTTCTGAGG
ATGCTCCTGTGAGGACTGGTGGGAAAACAGCCTCAGGCAACAGTCTCCTTGGAAGAGACCCCTGTGTGCC
TCAGTATTAGATGGTGGATCTCCCAGATCCTGCTGATGTTGCAGAAGGAGGGTCAGCAAGTATTTGAATT
TCTTGCATGGAGATCTGATTGTGAGTGTTTAAAAATAACCCCAGTTCCCTTCCCCACCCCATCAAGACAG
AAGCTGTGGAAAATGATTGTCAAATGAGATGGCAAGTTAGAGCATGTATCAGTTTTCCCCTACAGCATAT
TTCATATGTTTTTTTTTCCTAAGATTACATCAAGCTAATTGTGCAAGGTCAATTCACTTTGTAAGAAAAC
TCTCAGAGAAATAAATCAACAAAAAAATGCAAAAAAAAAAAAAAAAAAAAAAAAAAAA
nt 1688 - nt 2235 of NM_010791.3
Notes:The Meox1 (Mox-1) probe used in this study by Filosa et al, 1997 [PMID:9226455] is indicated as that used by Candia et al, 1992 [PMID:1363541] ie. a "550 bp Mox-1 fragment" of "the sequence between the PstI site, centered at nucleotide 1640 and the 3' end of the cDNA." nt1640 in the sequence in this paper equates to nt1688 in Candia's GenBank entry NM_010791.3.
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Strain:(129/Sv x C57BL/6) x (129/Sv x CD1)F1
Age:9.5 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Filosa et al, 1997 [PMID:9226455] . Indexed by GXD, Spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:9226455] Filosa S, Rivera-Perez JA, Gomez AP, Gansmuller A, Sasaki H, Behringer RR, Ang SL 1997 Goosecoid and HNF-3beta genetically interact to regulate neural tube patterning during mouse embryogenesis. Development (124):2843-54
 [ PMID:1363541] Candia AF, Hu J, Crosby J, Lalley PA, Noden D, Nadeau JH, Wright CV 1992 Mox-1 and Mox-2 define a novel homeobox gene Development (116):1123-36
Links:MGI:1338521 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI