Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6504

Mir680-1 microRNA 680-1 ( MGI:3629682)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6504 EMAGE:6504 EMAGE:6504 EMAGE:6504 EMAGE:6504
"Pseudo-wholemount" of euxassay_019063. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019063_01 euxassay_019063_02 euxassay_019063_03 euxassay_019063_04
EMAGE:6504 EMAGE:6504 EMAGE:6504 EMAGE:6504 EMAGE:6504
euxassay_019063_05 euxassay_019063_06 euxassay_019063_07 euxassay_019063_08 euxassay_019063_09
EMAGE:6504 EMAGE:6504 EMAGE:6504 EMAGE:6504 EMAGE:6504
euxassay_019063_10 euxassay_019063_11 euxassay_019063_12 euxassay_019063_13 euxassay_019063_14
EMAGE:6504 EMAGE:6504 EMAGE:6504 EMAGE:6504 EMAGE:6504
euxassay_019063_15 euxassay_019063_16 euxassay_019063_17 euxassay_019063_18 euxassay_019063_19
EMAGE:6504 EMAGE:6504 EMAGE:6504 EMAGE:6504 EMAGE:6504
euxassay_019063_20 euxassay_019063_21 euxassay_019063_22 euxassay_019063_23 euxassay_019063_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6504Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6504_wholemount_strong.wlz
6504_wholemount_moderate.wlz
6504_wholemount_weak.wlz
6504_wholemount_possible.wlz
6504_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6504_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
olfactory cortex mantle layer
weak weak
regionalweak expression: see section 10 11 12 15 17
trigeminal v ganglion
weak weak
single cellweak expression: see section 04 05 06 07 08 09 17 18
ventral grey horn
weak weak
regionalweak expression: see section 10 11 12 13 14
dorsal root ganglion
weak weak
regionalweak expression: see section 08 09 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70129
Entity Detected:Mir680-1, microRNA 680-1 ( MGI:3629682)
Sequence:sense strand is shown

>T70129
GGGCATCTGCTGACATGGGGG
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-680 was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6502 same assay
 EurExpress:euxassay_019063 same experiment
 EMAGE:6501 same embryo
 EMAGE:6503 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS