Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6584

Arl4c ADP-ribosylation factor-like 4C ( MGI:2445172)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6584 EMAGE:6584 EMAGE:6584 EMAGE:6584 EMAGE:6584
"Pseudo-wholemount" of euxassay_016423. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_016423_01 euxassay_016423_02 euxassay_016423_03 euxassay_016423_04
EMAGE:6584 EMAGE:6584 EMAGE:6584 EMAGE:6584 EMAGE:6584
euxassay_016423_05 euxassay_016423_06 euxassay_016423_07 euxassay_016423_08 euxassay_016423_09
EMAGE:6584 EMAGE:6584 EMAGE:6584 EMAGE:6584 EMAGE:6584
euxassay_016423_10 euxassay_016423_11 euxassay_016423_12 euxassay_016423_13 euxassay_016423_14
EMAGE:6584 EMAGE:6584 EMAGE:6584 EMAGE:6584 EMAGE:6584
euxassay_016423_15 euxassay_016423_16 euxassay_016423_17 euxassay_016423_18 euxassay_016423_19
EMAGE:6584 EMAGE:6584 EMAGE:6584 EMAGE:6584 EMAGE:6584
euxassay_016423_20 euxassay_016423_21 euxassay_016423_22 euxassay_016423_23 euxassay_016423_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6584Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6584_wholemount_strong.wlz
6584_wholemount_moderate.wlz
6584_wholemount_weak.wlz
6584_wholemount_possible.wlz
6584_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6584_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 21
telencephalon
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 22 23 24
hindbrain
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
midbrain
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
facial vii ganglion
moderate moderate
single cellmoderate expression: see section 04 05 06 20 21
glossopharyngeal ix ganglion
moderate moderate
single cellmoderate expression: see section 07 08 18 19
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 03 04 05 06 07 08 09 17 18 19 20 21 22
vestibulocochlear viii ganglion
moderate moderate
single cellmoderate expression: see section 07 18 19
trigeminal v nerve
moderate moderate
single cellmoderate expression: see section 09
spinal cord
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16
dorsal root ganglion
moderate moderate
single cellmoderate expression: see section 07 08 09 10 12 13 14 15 16 17 18 19
neural retina
moderate moderate
regionalmoderate expression: see section 01 weak expression: see section 02 03 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T63306
Entity Detected:Arl4c, ADP-ribosylation factor-like 4C ( MGI:2445172)
Sequence:sense strand is shown

>T63306
GTTGAGAACTGCTTTTCAGCCTGGGATGAGACCTCTTCCAGATGGCCTAGGCCCTGTCCGTGTGCAGGTC
ATTCTCTCGTAAAGAGACCAATAAAACAAAGAACAGAAAAACCATTGGAGGTGGTGGCAGTACAGGTGCT
TAAAGGGTGAGGGTCTCGACATTAATGCTGTGTGTGTACGCGCGCGTGCGTGTGTATGTGTGTGTGTGTG
TGTGCACTCGGTACTGCATAATCGGCATAAAAACTGGACCCTCTGGGTGGAATTTAAAAATCTCTCAGCC
TACTGATTGGTTTGGAAGACCACACCAGCTACAGATGTGTGCTGAATTGCAAAATGGTTTTCTTAACAAG
GGGGAGGGGGTCTGATAATAATACACGTGGTGATAGGTTTCAGACATTTAAAAAAAAAAACCAACAAAAA
ACACTTCCACAAATAAATTATCTTCACCTTAGGAGAAAAGGACTTTGCCCTTTTGTGGCCCTTGGTACTG
CAAGTGAAGACATGTTCAGATTTCTGAGCTGGGTCTTTGTGACCTATCTGGTTTCAGTATTTTACTCAAA
ATGTGTCATTAGAATATTTGATATCACTCACCAGAAGAATAAAACCCCACCTTGTAAAAGCTAACCCCGT
TTGCATGGAATTGAAGAGAGGAAAAGTCTAGAGGAAGAAGTCCTTTGGAAATCACCCTGGTGGGAGCCGG
CCTGGCCTCAGAGCCAGCCAGCACTTTTGGTTAAAGGCA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 142845. Forward Primer - name:142845_F_cDNA_Arl7, sequence:GTTGAGAACTGCTTTTCAGCCT; Reverse Primer - name:142845_N_SP6_cDNA_Arl7, sequence:TGCCTTTAACCAAAAGTGCTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6580 same embryo
 EMAGE:6581 same embryo
 EMAGE:6582 same embryo
 EMAGE:6583 same embryo
 EurExpress:euxassay_016423 same experiment
 MGI:4823239 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS