Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6621

Mir292 microRNA 292 ( MGI:3711325)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6621 EMAGE:6621 EMAGE:6621 EMAGE:6621 EMAGE:6621
"Pseudo-wholemount" of euxassay_019067. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019067_01 euxassay_019067_02 euxassay_019067_03 euxassay_019067_04
EMAGE:6621 EMAGE:6621 EMAGE:6621 EMAGE:6621 EMAGE:6621
euxassay_019067_05 euxassay_019067_06 euxassay_019067_07 euxassay_019067_08 euxassay_019067_09
EMAGE:6621 EMAGE:6621 EMAGE:6621 EMAGE:6621 EMAGE:6621
euxassay_019067_10 euxassay_019067_11 euxassay_019067_12 euxassay_019067_13 euxassay_019067_14
EMAGE:6621 EMAGE:6621 EMAGE:6621 EMAGE:6621 EMAGE:6621
euxassay_019067_15 euxassay_019067_16 euxassay_019067_17 euxassay_019067_18 euxassay_019067_19
EMAGE:6621 EMAGE:6621 EMAGE:6621 EMAGE:6621 EMAGE:6621
euxassay_019067_20 euxassay_019067_21 euxassay_019067_22 euxassay_019067_23 euxassay_019067_24
EMAGE:6621
euxassay_019067_25

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6621Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6621_wholemount_strong.wlz
6621_wholemount_moderate.wlz
6621_wholemount_weak.wlz
6621_wholemount_possible.wlz
6621_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6621_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 01 02 10 17 18 21 22 23 24 25 weak expression: see section 03 04 05 06 07 08 09 11 16 19 20
humerus
moderate moderate
regionalmoderate expression: see section 02 24 25 weak expression: see section 01 03 04 05 23
hindlimb digit 1 metatarsal
weak weak
regionalweak expression: see section 24
hindlimb digit 1 phalanx
weak weak
regionalweak expression: see section 24
hindlimb digit 2 metatarsal
weak weak
regionalweak expression: see section 05 24
hindlimb digit 2 phalanx
weak weak
regionalweak expression: see section 05 24
hindlimb digit 3 metatarsal
weak weak
regionalweak expression: see section 05 24
hindlimb digit 3 phalanx
weak weak
regionalweak expression: see section 05 06 23 24
hindlimb digit 4 phalanx
weak weak
regionalweak expression: see section 06 23
hindlimb digit 5 phalanx
weak weak
regionalweak expression: see section 23
fibula
weak weak
regionalweak expression: see section 01 02 03
tibia
weak weak
regionalweak expression: see section 02 03
femur
moderate moderate
regionalmoderate expression: see section 24 25 weak expression: see section 02 04 05 06 07 08 09 21 22 23
otic capsule
weak weak
regionalweak expression: see section 08 09 10 17 18
hyoid
weak weak
regionalweak expression: see section 11 12 13 14 15
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 10 11 12 17 18 19 20 21 22 23 24 weak expression: see section 03 04 05 06 07 08 09 15 16
axial skeleton
moderate moderate
regionalmoderate expression: see section 09 10 17 18 weak expression: see section 08 11 12 13 14 15 16
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 09 17 18 weak expression: see section 10 11 12 13 14 15 16
exoccipital bone
moderate moderate
regionalmoderate expression: see section 21 weak expression: see section 04 05 06 19 20
temporal bone
moderate moderate
regionalmoderate expression: see section 21 weak expression: see section 04 05 06 19 20
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 09 21 22 weak expression: see section 07 08 11 12 13 14 15 16 19 20
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
scapula
moderate moderate
regionalmoderate expression: see section 23 24 25 weak expression: see section 02 03 04
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 18 weak expression: see section 11 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70367
Entity Detected:Mir292, microRNA 292 ( MGI:3711325)
Sequence:sense strand is shown

>T70367
ACTCAAACTGGGGGCTCTTTTG
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-292-5p was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6622 same embryo
 EMAGE:6623 same embryo
 EurExpress:euxassay_019067 same experiment
 MGI:4826254 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS