Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6653

Igsf8 immunoglobulin superfamily, member 8 ( MGI:2154090)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6653 EMAGE:6653 EMAGE:6653 EMAGE:6653 EMAGE:6653
"Pseudo-wholemount" of euxassay_002218. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_002218_01 euxassay_002218_02 euxassay_002218_03 euxassay_002218_04
EMAGE:6653 EMAGE:6653 EMAGE:6653 EMAGE:6653 EMAGE:6653
euxassay_002218_05 euxassay_002218_06 euxassay_002218_07 euxassay_002218_08 euxassay_002218_09
EMAGE:6653 EMAGE:6653 EMAGE:6653 EMAGE:6653 EMAGE:6653
euxassay_002218_10 euxassay_002218_11 euxassay_002218_12 euxassay_002218_13 euxassay_002218_14
EMAGE:6653 EMAGE:6653 EMAGE:6653 EMAGE:6653 EMAGE:6653
euxassay_002218_15 euxassay_002218_16 euxassay_002218_17 euxassay_002218_18 euxassay_002218_19
EMAGE:6653 EMAGE:6653 EMAGE:6653 EMAGE:6653 EMAGE:6653
euxassay_002218_20 euxassay_002218_21 euxassay_002218_22 euxassay_002218_23 euxassay_002218_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6653Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6653_wholemount_strong.wlz
6653_wholemount_moderate.wlz
6653_wholemount_weak.wlz
6653_wholemount_possible.wlz
6653_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6653_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
hypothalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 04 05 06 16 17 19 20
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 08 09 14 15 16
midbrain ventricular layer
strong strong
regionalstrong expression: see section 08 moderate expression: see section 09 10 11 12 13 14 15 16 17 18
nasal cavity epithelium
moderate moderate
regionalmoderate expression: see section 17
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 09 10 13 14 15 17
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 03 04 05 07 08 weak expression: see section 09 10 15 16 17 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2977
Entity Detected:Igsf8, immunoglobulin superfamily, member 8 ( MGI:2154090)
Sequence:sense strand is shown

>T2977
TGGCCTCGAGCCAGATTCGGACGAGGCGGATTGGCCCAGGCGAACCCTTAGAACTGCTGTGCAATGTGTC
CGGTGCACTGCCCCCACCAGGCCGTCATGCTGCGTACTCTGTGGGCTGGGAGATGGCCCCTGCAGGGGCT
CCTGGACCCGGCCGCCTGGTGGCCCAGCTGGACACGGAAGGTATAGGCAGCCTGGGCCCTGGCTATGAGG
ACCGGCACATTGCCATGGAGAAAGTAGCATCCAGAACCTACCGACTGCGGCTGGAGGCTGCCAGGCCCGC
TGATGCAGGCACCTACCGCTGCCTCGCCAAAGCCTATGTTCGAGGGTCTGGGACCCGGCTTCGTGAAGCG
GCCAGTGCTCGTTCCCGGCCTCTCCCTGTGCATGTGAGAGAAGAAGGCGTGGTGCTAGAGGCTGTGGCGT
GGCTAGCAGGGGGCACTGTGTACCGGGGAGAAACGGCCTCCCTGCTATGCAACATATCTGTGCGGGGCGG
CCCCCCAGGGCTGCGACTAGCAGCCAGCTGGTGGGTGGAGAGGCCAGAGGAGGGCGA
Notes:The probe template was PCR amplified from IMAGE:1532939 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1532939 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6652 same embryo
 EMAGE:6651 same embryo
 EMAGE:6655 same embryo
 EMAGE:6654 same embryo
 EMAGE:6650 same embryo
 EurExpress:euxassay_002218 same experiment
 MGI:4825548 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS