Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6673

Ptgfrn prostaglandin F2 receptor negative regulator ( MGI:1277114)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6673 EMAGE:6673 EMAGE:6673 EMAGE:6673 EMAGE:6673
"Pseudo-wholemount" of euxassay_007366. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007366_01 euxassay_007366_02 euxassay_007366_03 euxassay_007366_04
EMAGE:6673 EMAGE:6673 EMAGE:6673 EMAGE:6673 EMAGE:6673
euxassay_007366_05 euxassay_007366_06 euxassay_007366_07 euxassay_007366_08 euxassay_007366_09
EMAGE:6673 EMAGE:6673 EMAGE:6673 EMAGE:6673 EMAGE:6673
euxassay_007366_10 euxassay_007366_11 euxassay_007366_12 euxassay_007366_13 euxassay_007366_14
EMAGE:6673 EMAGE:6673 EMAGE:6673 EMAGE:6673 EMAGE:6673
euxassay_007366_15 euxassay_007366_16 euxassay_007366_17 euxassay_007366_18 euxassay_007366_19
EMAGE:6673 EMAGE:6673 EMAGE:6673 EMAGE:6673
euxassay_007366_20 euxassay_007366_21 euxassay_007366_22 euxassay_007366_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6673Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6673_wholemount_strong.wlz
6673_wholemount_moderate.wlz
6673_wholemount_weak.wlz
6673_wholemount_possible.wlz
6673_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6673_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
submandibular gland primordium
weak weak
regionalweak expression: see section 06 07 16 17 18 19
vibrissa
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 18 19 20 21
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 11 moderate expression: see section 12
telencephalon mantle layer
strong strong
regionalstrong expression: see section 03 04 05 18 19 20 21
olfactory cortex ventricular layer
strong strong
regionalstrong expression: see section 09 10 moderate expression: see section 14
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 15 16 17 18 19 20 21 22 moderate expression: see section 13 14
medulla oblongata floor plate
strong strong
spottedstrong expression: see section 13
metencephalon floor plate
strong strong
spottedstrong expression: see section 13
midbrain ventricular layer
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 moderate expression: see section 09 17
spinal cord floor plate
strong strong
spottedstrong expression: see section 10 11 12 13
palatal shelf
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15
genital tubercle of male
weak weak
regionalweak expression: see section 10 11 13 14
lung
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 21
axial skeleton
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13
clavicle
moderate moderate
regionalmoderate expression: see section 09 10 11 16 17 weak expression: see section 08 18
sternum
moderate moderate
regionalmoderate expression: see section 10 11 12 14 15 16 17 weak expression: see section 07 08 09
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 12 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3047
Entity Detected:Ptgfrn, prostaglandin F2 receptor negative regulator ( MGI:1277114)
Sequence:sense strand is shown

>T3047
TGGCCTCGAGCCAGATTCGTCGACTCGTGGCAGAGGCCATGTCTGCCCCGTCTGGTGTAAGCGTGACCTG
GCTAGAACCAGAATACCAGGTCTACCTGAACGCTTCTAAGGTCCCCGGGTTTTCAGACGACCCCACGGAA
CTGCAGTGCCGGGTGATAGACACGAAGCGTCTGGAGGCCGGTGTCCGACTTACCGTGTCGTGGTACTATA
GAATGACCCGTCGCAATGACGACGTGGTGGCCAGTGAGCTTCTCGCAGTCATGGATGGGGACTGGACTCT
GAGATATGGAGAGAGGAGCAAGCAGCGGGCCCAGGACGGAGAGTTTATTTTTTCTAAGGAGCACACAGAC
ACATTCAATTTCCGGATCCAAAGGACTACGGAGGAAGACAGGGGCAATTATTACTGTGTTGTGTCTGCCT
GGACCAGGCAGAGGAACAACAGCTGGGTGAAGAGCAAAGATGTCTTCTCCAAGCCTGTCAACATATTCTG
GGCCTCAGAAGATTCTGTGCTCGTGGTGAAGGCACGGCAGCCAAAGCCTTTCTTTGCTGCAGGGAATACA
TTT
Notes:The probe template was PCR amplified from IMAGE:1546140 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1546140 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6676 same embryo
 EMAGE:6674 same embryo
 EMAGE:6675 same embryo
 EMAGE:6677 same embryo
 EMAGE:6672 same embryo
 EurExpress:euxassay_007366 same experiment
 MGI:4827508 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS