EMAGE mouse gene expression spatial database

EMAGE:6674

Adam19 a disintegrin and metallopeptidase domain 19 (meltrin beta) ( MGI:105377)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_002478. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_002478_01	euxassay_002478_02	euxassay_002478_03	euxassay_002478_04

euxassay_002478_05	euxassay_002478_06	euxassay_002478_07	euxassay_002478_08	euxassay_002478_09

euxassay_002478_10	euxassay_002478_11	euxassay_002478_12	euxassay_002478_13	euxassay_002478_14

euxassay_002478_15	euxassay_002478_16	euxassay_002478_17	euxassay_002478_18	euxassay_002478_19

euxassay_002478_20	euxassay_002478_21	euxassay_002478_22	euxassay_002478_23	euxassay_002478_24

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Text Annotation:

Structure

Level

Pattern

Notes

medulla oblongata basal plate mantle layer

moderate

regional

moderate expression: see section 08 09 15 16

bladder

moderate

regional

moderate expression: see section 09 10 11 12

Annotation Validation:

spatial mapping by EMAGE editor, text annotation by author

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T2037
Entity Detected:	Adam19, a disintegrin and metallopeptidase domain 19 (meltrin beta) ( MGI:105377)
Sequence:	sense strand is shown >T2037 CTTGTATTCTTAAAATTGGAGGCTAGTTATTTTGTCAAATGCATGTAATGAACAGACCCGAAGGAATCCT CCACACACAAGCCAGGGAACACCAACTGGAAAGGTACCCCGTCCCAGGGAAGCCTGCTAGGGAGAGGTTC TGTAGAATCCGAGCCTAGCACCCCAAAGTCATGCACCCAGTATCCTCTTGTATGACTGTATATGTCTATG TCTGGGATCCAGGGCAAATGTGAATTTTCTTTTGATTTGGGAGATTGTTCACAGGAAGTAGTCCTCCCCT CTCATGTCCTCCTATTGATTGTTTACAATATTTGTACATCTATGCAAAATACTTGAATGGGCCATGGTGC CTTGTTTTTTGTTGTTGTTGTTATTTTTTTCTCCTTGTTTGTATTTAATTAAAACAAATTGTCATGAGAA AAAAAAAAAAAAA
Notes:	The probe template was PCR amplified from IMAGE:751823 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:751823 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:6675 same assay
	EMAGE:6676 same embryo
	EMAGE:6677 same embryo
	EMAGE:6673 same embryo
	EurExpress:euxassay_002478 same experiment
	MGI:4822975 same experiment
	EMAGE:6672 same embryo
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source