Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6689

Hba-a1 hemoglobin alpha, adult chain 1 ( MGI:96015)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6689 EMAGE:6689 EMAGE:6689 EMAGE:6689 EMAGE:6689
euxassay_007200_01 euxassay_007200_02 euxassay_007200_03 euxassay_007200_04 euxassay_007200_05
EMAGE:6689 EMAGE:6689 EMAGE:6689 EMAGE:6689 EMAGE:6689
euxassay_007200_06 euxassay_007200_07 euxassay_007200_08 euxassay_007200_09 euxassay_007200_10
EMAGE:6689 EMAGE:6689 EMAGE:6689 EMAGE:6689 EMAGE:6689
euxassay_007200_11 euxassay_007200_12 euxassay_007200_13 euxassay_007200_14 euxassay_007200_15
EMAGE:6689 EMAGE:6689 EMAGE:6689 EMAGE:6689 EMAGE:6689
euxassay_007200_16 euxassay_007200_17 euxassay_007200_18 euxassay_007200_19 euxassay_007200_20
EMAGE:6689 EMAGE:6689 EMAGE:6689 EMAGE:6689
euxassay_007200_21 euxassay_007200_22 euxassay_007200_23 euxassay_007200_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6689Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6689_wholemount_strong.wlz
6689_wholemount_moderate.wlz
6689_wholemount_weak.wlz
6689_wholemount_possible.wlz
6689_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6689_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3987
Entity Detected:Hba-a1, hemoglobin alpha, adult chain 1 ( MGI:96015)
Sequence:sense strand is shown

>T3987
TGGCCTCGAGCCAGATTCGGACGAGGGCAACAAGGTCGCCGATGCTCTGGCCAATGCTGCAGGCCACCTC
GATGACCTGCCCGGTGCCCTGTCTGCTCTGAGCGACCTGCATGCCCACAAGCTGCGTGTGGATCCCGTCA
ACTTCAAGCTCCTGAGCCACTGCCTGCTGGTGACCTTGGCTAGCCACCACCCTGCCGATTTCACCCCCGC
GGTGCATGCCTCTCTGGACAAATTCCTTGCCTCTGTGAGCACCGTGCTGACCTCCAAGTACCGTTAAGCT
GCCTTCTGCGGGGCTTGCCTTCTGGCCATGCCCTTCTTCTCTCCCTTGCACCTGTACCTCTTGGTCTTTG
AATAAAGCCTGAGTAGGAAGAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:463843 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:463843 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6692 same embryo
 EMAGE:6690 same embryo
 EMAGE:6691 same embryo
 EurExpress:euxassay_007200 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS