Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6720

Gdf10 growth differentiation factor 10 ( MGI:95684)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6720 EMAGE:6720 EMAGE:6720 EMAGE:6720 EMAGE:6720
"Pseudo-wholemount" of euxassay_002299. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_002299_01 euxassay_002299_02 euxassay_002299_03 euxassay_002299_04
EMAGE:6720 EMAGE:6720 EMAGE:6720 EMAGE:6720 EMAGE:6720
euxassay_002299_05 euxassay_002299_06 euxassay_002299_07 euxassay_002299_08 euxassay_002299_09
EMAGE:6720 EMAGE:6720 EMAGE:6720 EMAGE:6720 EMAGE:6720
euxassay_002299_10 euxassay_002299_11 euxassay_002299_12 euxassay_002299_13 euxassay_002299_14
EMAGE:6720 EMAGE:6720 EMAGE:6720 EMAGE:6720 EMAGE:6720
euxassay_002299_15 euxassay_002299_16 euxassay_002299_17 euxassay_002299_18 euxassay_002299_19
EMAGE:6720 EMAGE:6720 EMAGE:6720 EMAGE:6720
euxassay_002299_20 euxassay_002299_21 euxassay_002299_22 euxassay_002299_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6720Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6720_wholemount_strong.wlz
6720_wholemount_moderate.wlz
6720_wholemount_weak.wlz
6720_wholemount_possible.wlz
6720_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6720_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 16 17 18 19 20 21
diaphragm
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
humerus
moderate moderate
regionalmoderate expression: see section 03 04 05 19 20 21 22
hand mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 20 21 22 23
hand epidermis
strong strong
regionalstrong expression: see section 01 02 03 20 21 22 23
hindlimb digit 2 metatarsal
strong strong
regionalstrong expression: see section 04
hindlimb digit 3 metatarsal
strong strong
regionalstrong expression: see section 04 06
hindlimb digit 4 metatarsal
strong strong
regionalstrong expression: see section 06 07
hindlimb digit 5 metatarsal
strong strong
regionalstrong expression: see section 06 07
foot mesenchyme
strong strong
regionalstrong expression: see section 03 04 05 06 08 22
foot epidermis
strong strong
regionalstrong expression: see section 03 04 05 06 07 23
hip
strong strong
regionalstrong expression: see section 03 23
lower leg
strong strong
regionalstrong expression: see section 03 23
upper leg
strong strong
regionalstrong expression: see section 01 02 22 23
femur
strong strong
regionalstrong expression: see section 07 08 18 19
head mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
body-wall mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 11 13
diencephalon lateral wall marginal layer
moderate moderate
regionalmoderate expression: see section 12 13
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 13
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 04 05 06 08 09 10 14 15 16 19 20 21 22 moderate expression: see section 03
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 17 18 19 20 21 22 23
midbrain ventricular layer
strong strong
regionalstrong expression: see section 14 15
dorsal grey horn
strong strong
regionalstrong expression: see section 12 13 14 15
otic capsule
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 16 17 18 19 20 21 22 23
nasal septum
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13
viscerocranium
strong strong
regionalExpression in the turbinate bone.
tongue
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13
lower lip
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
upper lip
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 11 12 13 15 16 17 18 19
trachea
strong strong
regionalstrong expression: see section 13 14
cranium
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
axial skeleton tail region
strong strong
regionalstrong expression: see section 12 13 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3301
Entity Detected:Gdf10, growth differentiation factor 10 ( MGI:95684)
Sequence:sense strand is shown

>T3301
TGGCCTCGAGCCAGAATTCGGAACGAGGAAGACCGCAAGAAGAAGGACCAGGACACATTCACCGCCGCCT
CCTCTCAGGTGCTGGACTTTGACGAGAAGACGATGCAGAAAGCCAGGAGGCGGCAGTGGGATGAGCCCCG
GGTCTGCTCCAGGAGGTACCTGAAGGTGGATTTTGCAGACATCGGGTGGAATGAATGGATCATCTCTCCC
AAATCCTTTGACGCCTACTACTGTGCTGGGGCCTGCGAGTTCCCCATGCCCAAGATTGTCCGCCCATCCA
ACCATGCCACCATCCAGAGCATCGTCAGAGCTGTGGGCATTGTCCCTGGCATCCCAGAGCCATGCTGTGT
TCCAGACAAGATGAACTCCCTTGGAGTCCTTTTCCTGGATGAAAATCGGAATGCGGTTCTGAAGGTGTAC
CCCAATATGTCCGTAGAGACCTGTGCCTGTCGGTAAGATGGCTTCAAGATAGAAGACAGACCTGCTTCAT
CCCTGCCCTGCAGAGTGGCAATCTTGGAGCCAGGGCTTGACTCGGGGAGGTTCCAGG
Notes:The probe template was PCR amplified from IMAGE:2780664 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2780664 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6722 same embryo
 EMAGE:6721 same embryo
 EMAGE:6724 same embryo
 EMAGE:6719 same embryo
 EMAGE:6723 same embryo
 EurExpress:euxassay_002299 same experiment
 MGI:4825032 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS