Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:673

Slc2a3 solute carrier family 2 (facilitated glucose transporter), member 3 ( MGI:95757)
TS15 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:673
Figure 5C of Smith and Gridley, 1992 [PMID:1289053] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: three stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
Image annotations: se - surface ectoderm; h - heart.
Expression Pattern Description
Spatial Annotation:
EMAGE:673EMAGE:673Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D context movie

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
673_voxel_strong_3D_1.wlz
673_voxel_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:673_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
surface ectoderm
detected detected
regionalExpression is observed in surface ectoderm of the head.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:8893
Entity Detected:Slc2a3, solute carrier family 2 (facilitated glucose transporter), member 3 ( MGI:95757)
Sequence:sense strand is shown

>MGI:8893
GCATTTGGCACACTAAACCAGCTGGGCATCGTTGTTGGGATTCTGGTAGCTCAGATCTTTGGTTTGGACT
TTATTCTGGGCTCTGAAGAACTGTGGCCTGGGCTCCTTGGCTTAACCATCATTCCAGCTATCCTGCAAAG
CGCAGCCCTTCCATTTTGCCCTGAGAGTCCAAGATTCTTGCTCATTAACAAAAAGGAGGAAGACCAAGCT
ACAGAGATCCTGCAGCGCTTGTGGGGCACCTCGGACGTG
nt 1 - nt 249 of X69698.1
Notes:The Slc2a3 (Glut3) probe used in this study by Smith & Gridley, 1992 [PMID:1289053] is described as: "the portion of clone 103 identical to mouse Glut-3". A comparison of clone 103 and the mouse Glut-3 cDNA (Nagamatsu et al.,1992 [PMID:1730609] ) is shown in Fig2B therein. The probe was hydrolysed to an average length of 100 bases.
Chemistry:RNA
Strand:antisense
Label:S35
Specimen
Organism:mouse
Age:9.5 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:4% paraformaldehyde
Embedding:paraffin
Staining procedure:autoradiography
General Information
Authors:Smith & Gridley, 1992 [PMID:1289053] Indexed by GXD, Spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:1289053] Smith DE, Gridley T 1992 Differential screening of a PCR-generated mouse embryo cDNA library: glucose transporters are differentially expressed in early postimplantation mouse embryos. Development (116):555-61
 [ PMID:1730609] Nagamatsu S, Kornhauser JM, Burant CF, Seino S, Mayo KE, Bell GI 1992 Glucose transporter expression in brain. cDNA sequence of mouse GLUT3, the brain facilitative glucose transporter isoform, and identification of sites of expression by in situ hybridization. J Biol Chem (267):467-72
Links:MGI:1342821 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI