Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6740

Sept3 septin 3 ( MGI:1345148)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6740 EMAGE:6740 EMAGE:6740 EMAGE:6740 EMAGE:6740
"Pseudo-wholemount" of euxassay_002266. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_002266_01 euxassay_002266_02 euxassay_002266_03 euxassay_002266_04
EMAGE:6740 EMAGE:6740 EMAGE:6740 EMAGE:6740 EMAGE:6740
euxassay_002266_05 euxassay_002266_06 euxassay_002266_07 euxassay_002266_08 euxassay_002266_09
EMAGE:6740 EMAGE:6740 EMAGE:6740 EMAGE:6740 EMAGE:6740
euxassay_002266_10 euxassay_002266_11 euxassay_002266_12 euxassay_002266_13 euxassay_002266_14
EMAGE:6740 EMAGE:6740 EMAGE:6740 EMAGE:6740 EMAGE:6740
euxassay_002266_15 euxassay_002266_16 euxassay_002266_17 euxassay_002266_18 euxassay_002266_19
EMAGE:6740 EMAGE:6740 EMAGE:6740 EMAGE:6740
euxassay_002266_20 euxassay_002266_21 euxassay_002266_22 euxassay_002266_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6740Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6740_wholemount_strong.wlz
6740_wholemount_moderate.wlz
6740_wholemount_weak.wlz
6740_wholemount_possible.wlz
6740_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6740_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
facial vii ganglion
strong strong
regionalstrong expression: see section 04 20 21 22
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 07 18 19 moderate expression: see section 08
trigeminal v ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 08 17 18 19 20 21 22 moderate expression: see section 09
vagus x ganglion
strong strong
regionalstrong expression: see section 16 17 moderate expression: see section 09 10
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 06 07 17 18 19 moderate expression: see section 08
spinal cord
strong strong
homogeneousstrong expression: see section 10 11 12 13 14 15 16 17 18
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 10 16
cervical ganglion
moderate moderate
regionalmoderate expression: see section 10 16
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 13 14 15 16
dorsal root ganglion
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 17 18 19 moderate expression: see section 07 08
not examined not examined
regionalnot examined expression: see section 01 02 03 04 22 23
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 04 22 23
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 10 11 12 14 15 moderate expression: see section 17 18 weak expression: see section 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3337
Entity Detected:Sept3, septin 3 ( MGI:1345148)
Sequence:sense strand is shown

>T3337
TGATGGAGAGTGCCTGTGTGTGTGTATGCATGTGTGTGTATGTATGCGTGTACTCAGGGGTGAGGTATTT
TCATTGCCCTCTTTGGAAAGTCCTTTGTAAGTCTGCTTTCTCCATGACTCTCCATTCTGTCTCCTTTTTT
CTTGTGCTCCAGAACAAAAAGCTGTGCGCCTCACTCAAGAGGTCTGGGGAAGGTTTTAATTTATAATGCT
GGGAGCAGGTGAGCCACAGGCAACTCTTTCTTACTTCTGACCCACCCACAAACTGGGGCTGCAAGTATTC
TTCATGGACTGGTGGCTGAGCTAGCCTGTGGTGGGCTGTGGGAGCTCAGAACAACTTTTCACTGTAAGTT
GAGGTAATCTGGAGGAAGGCTAGGACTTCTTGGGGAAACAGAAGATTCGTGGGGAGCAGAGAAGAAAGCT
GAGGGGCTCCTGCAGAATTGGTGTCTGANAATGGAGCTCCACCCTTGTGTCTATGTTGGGGTCACTGTCA
AACAGCGGATCATCACCGCTGCAAACCACT
Notes:The probe template was PCR amplified from IMAGE:315515 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:315515 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6738 same embryo
 EMAGE:6737 same embryo
 EMAGE:6739 same embryo
 EurExpress:euxassay_002266 same experiment
 MGI:4827960 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS