Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6768

Socs6 suppressor of cytokine signaling 6 ( MGI:1924885)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6768 EMAGE:6768 EMAGE:6768 EMAGE:6768 EMAGE:6768
"Pseudo-wholemount" of euxassay_007334. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007334_01 euxassay_007334_02 euxassay_007334_03 euxassay_007334_04
EMAGE:6768 EMAGE:6768 EMAGE:6768 EMAGE:6768 EMAGE:6768
euxassay_007334_05 euxassay_007334_06 euxassay_007334_07 euxassay_007334_08 euxassay_007334_09
EMAGE:6768 EMAGE:6768 EMAGE:6768 EMAGE:6768 EMAGE:6768
euxassay_007334_10 euxassay_007334_11 euxassay_007334_12 euxassay_007334_13 euxassay_007334_14
EMAGE:6768 EMAGE:6768 EMAGE:6768 EMAGE:6768 EMAGE:6768
euxassay_007334_15 euxassay_007334_16 euxassay_007334_17 euxassay_007334_18 euxassay_007334_19
EMAGE:6768 EMAGE:6768 EMAGE:6768 EMAGE:6768 EMAGE:6768
euxassay_007334_20 euxassay_007334_21 euxassay_007334_22 euxassay_007334_23 euxassay_007334_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6768Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6768_wholemount_strong.wlz
6768_wholemount_moderate.wlz
6768_wholemount_weak.wlz
6768_wholemount_possible.wlz
6768_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6768_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 10 11 18 19
lower jaw alveolar sulcus
strong strong
regionalstrong expression: see section 07 08 10 11 15 16 19 moderate expression: see section 12 20
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 13 14
lower jaw molar
strong strong
regionalstrong expression: see section 08 09 17 18
upper jaw alveolar sulcus
strong strong
regionalstrong expression: see section 07 08 10 11 15 16 19 moderate expression: see section 12 20
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 12 14
upper jaw molar
strong strong
regionalstrong expression: see section 08 09 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3014
Entity Detected:Socs6, suppressor of cytokine signaling 6 ( MGI:1924885)
Sequence:sense strand is shown

>T3014
TGGCCTCGAGCAGATTCGGACGAGGGCGCAGCTGCTGCCTGGATACGTCTTCTCCCATGGAGGTGTCAGC
CGTACCCCTGCCGGGGGCGAGTGGTGCCTTCTCCGAAGACGACAGTCATGTGGACCAGGACCTGGTTGTA
GGCCCAGAGATCCTTGTGGATTCATCAGTGAACAATTTGTTGATTGGCACCACAGGAGTCATGTTGCAGA
GCCCTAGAGGAGGTCATGATGACGCCCCTCCCCTCTCACCATTGCTACCTCCAATGCAGAATAACCCAAT
CCAAAGGAACTTCAGTGGCCTCTCGGGCCCAGACTTGCACATGGCCGAAAGTGTTCGCTGTCATTTGAAT
TTCGATCCCAACTCTGCGCCTGGGGTTGCTAGAGTTTATGACTCGGTGCAAAGTAGTGGCCCCATGGTTG
TTACAAGTCTTACGGAGGAGCTGAAGAAGCTTGCAAAACAGGGGTGGTATTGGGGCCCCATCACACGCTG
GGAGGCAGAGGGGAAGTTGGCAAATGTGCCAGATGGTTCTTTTCTTGTAAGGGATAGTTCTG
Notes:The probe template was PCR amplified from IMAGE:1533469 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1533469 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6769 same embryo
 EMAGE:6770 same embryo
 EMAGE:6771 same embryo
 EurExpress:euxassay_007334 same experiment
 MGI:4828373 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS