Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6816

Irf6 interferon regulatory factor 6 ( MGI:1859211)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6816 EMAGE:6816 EMAGE:6816 EMAGE:6816 EMAGE:6816
"Pseudo-wholemount" of euxassay_003276. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_003276_01 euxassay_003276_02 euxassay_003276_03 euxassay_003276_04
EMAGE:6816 EMAGE:6816 EMAGE:6816 EMAGE:6816 EMAGE:6816
euxassay_003276_05 euxassay_003276_06 euxassay_003276_07 euxassay_003276_08 euxassay_003276_09
EMAGE:6816 EMAGE:6816 EMAGE:6816 EMAGE:6816 EMAGE:6816
euxassay_003276_10 euxassay_003276_11 euxassay_003276_12 euxassay_003276_13 euxassay_003276_14
EMAGE:6816 EMAGE:6816 EMAGE:6816 EMAGE:6816 EMAGE:6816
euxassay_003276_15 euxassay_003276_16 euxassay_003276_17 euxassay_003276_18 euxassay_003276_19
EMAGE:6816 EMAGE:6816 EMAGE:6816 EMAGE:6816 EMAGE:6816
euxassay_003276_20 euxassay_003276_21 euxassay_003276_22 euxassay_003276_23 euxassay_003276_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6816Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6816_wholemount_strong.wlz
6816_wholemount_moderate.wlz
6816_wholemount_weak.wlz
6816_wholemount_possible.wlz
6816_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6816_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
strong strong
regionalstrong expression: see section 20 moderate expression: see section 07 08 09 10 17 18 19
foregut-midgut junction
moderate moderate
regionalmoderate expression: see section 15 16
epidermis
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
vibrissa
strong strong
regionalstrong expression: see section 06 07 08 09 10 moderate expression: see section 05 20 21 22 23 24
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 01 moderate expression: see section 02 03 04 05 06 07 23 24
naris
moderate moderate
regionalmoderate expression: see section 16 17 weak expression: see section 13 14
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 20 moderate expression: see section 09 10 11 12 16 17 18 19 weak expression: see section 15
esophagus
moderate moderate
regionalmoderate expression: see section 13 14
stomach
strong strong
regionalstrong expression: see section 03 04 05 06 07 weak expression: see section 08 09
hindgut
moderate moderate
regionalmoderate expression: see section 14 15
rectum
moderate moderate
regionalmoderate expression: see section 13
midgut
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17
lower jaw incisor
strong strong
regionalstrong expression: see section 11 12 13 16 moderate expression: see section 17
lower jaw molar
strong strong
regionalstrong expression: see section 08 09 19 20
oral epithelium
strong strong
regionalstrong expression: see section 09 10 13 14 15 20 moderate expression: see section 07 08 11 12 16 17 18 19 21 22
upper jaw incisor
strong strong
regionalstrong expression: see section 12 13 16 moderate expression: see section 17
upper jaw molar
strong strong
regionalstrong expression: see section 08 09 19 20
bladder
strong strong
regionalstrong expression: see section 13 14 15
kidney calyx
moderate moderate
regionalmoderate expression: see section 17 19
kidney pelvis
moderate moderate
regionalmoderate expression: see section 18
urethra of male
strong strong
regionalstrong expression: see section 13 14
thyroid cartilage
moderate moderate
regionalmoderate expression: see section 12 13 14
trachea
moderate moderate
regionalmoderate expression: see section 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3295
Entity Detected:Irf6, interferon regulatory factor 6 ( MGI:1859211)
Sequence:sense strand is shown

>T3295
TGTTCNNAAAAGTNAAAAGTAACCCATTACATANNNAGTGGGAGGGTAGCTGTGGAATAGGGGACATTTC
CTTTCCCTTCTGTGACAAGTCAGCAGGCTATGAGGAATGTCCAGACAACAGGATCTGGTAAAGAATGTTG
AAAAATATGTTCTGAGGGCTATGGATTGAGTTATTAGTGTGTGACCATAATGAAAAATTGACAAATATGT
TGGGACAATGCATGATTTTGTGTGGTCCTATCTAGGCAGTCCAGTTTCTTGTCTTGCATCTTTTTCGGAA
TGCTGGGAGCACACACTACATGCAGGATCTTCTCTTGTCATATTCAGTAAGCTTTCTCTGGTTTTAGTAG
ATACCAAGTCCCCAGGAGCTCTAAGTTTCCCAATGCTCCCATTCACTCTCCAGCTGTCTTCTTCCTGCCT
TCATTTGAAGACTCAGAAGGGAGGAGGATTTCCCCCAGTTCCTCCTTTTCCTTACTGTGCACTCCANATT
AACTCCAATGTTAAAAGAAN
Notes:The probe template was PCR amplified from IMAGE:2780468 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2780468 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6815 same embryo
 EMAGE:6813 same embryo
 EMAGE:6814 same embryo
 EMAGE:6812 same embryo
 EMAGE:6811 same embryo
 EurExpress:euxassay_003276 same experiment
 MGI:4825619 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS