Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6849

Vstm2b V-set and transmembrane domain containing 2B ( MGI:1914525)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6849 EMAGE:6849 EMAGE:6849 EMAGE:6849 EMAGE:6849
"Pseudo-wholemount" of euxassay_002292. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_002292_01 euxassay_002292_02 euxassay_002292_03 euxassay_002292_04
EMAGE:6849 EMAGE:6849 EMAGE:6849 EMAGE:6849 EMAGE:6849
euxassay_002292_05 euxassay_002292_06 euxassay_002292_07 euxassay_002292_08 euxassay_002292_09
EMAGE:6849 EMAGE:6849 EMAGE:6849 EMAGE:6849 EMAGE:6849
euxassay_002292_10 euxassay_002292_11 euxassay_002292_12 euxassay_002292_13 euxassay_002292_14
EMAGE:6849 EMAGE:6849 EMAGE:6849 EMAGE:6849 EMAGE:6849
euxassay_002292_15 euxassay_002292_16 euxassay_002292_17 euxassay_002292_18 euxassay_002292_19
EMAGE:6849 EMAGE:6849
euxassay_002292_20 euxassay_002292_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6849Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6849_wholemount_strong.wlz
6849_wholemount_moderate.wlz
6849_wholemount_weak.wlz
6849_wholemount_possible.wlz
6849_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6849_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
olfactory cortex marginal layer
strong strong
regionalstrong expression: see section 08 09 10 12 13 14 15
medulla oblongata alar plate mantle layer
strong strong
single cellstrong expression: see section 08 09 10 11 13 14 15 16 17
medulla oblongata basal plate mantle layer
strong strong
single cellstrong expression: see section 08 09 10 11 13 14 15 16 17
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 12
pons mantle layer
strong strong
single cellstrong expression: see section 09 10 11 13 14 15 16
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 14 15 16 17
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3353
Entity Detected:Vstm2b, V-set and transmembrane domain containing 2B ( MGI:1914525)
Sequence:sense strand is shown

>T3353
CTTCNGNANNTGCTGCTTCTTCATCAGCATCACCACCATCAGGGCAGGCTGTCCTTCTGCGCCAGAGGCA
CGGCTCCGGTACCGGCCCAGGCTACAGTGCCGATCCTCTGCTGTCTCTGCTCTTGTTAGCACTACATAAG
TTCCTGCACCCACTTCTGGGCCACTGACAGCCGTCAAACCTCAGCAGGCACCCTGGGAGGACACCTTGCC
ACATGGACACAGGGACTGAGGGAAGCATGAAGAAGTCCATGCAAAAATAAATAAATCATATTTTTGGGGA
AGTAACACAGATCTAGAAGACTTAAAATAATGCATCAATTTTCCAAATAGGATGGGGTGCAGGCCGTGCG
GTGTGCATGGGGCGCCAAGTTCTTCACGGCAATGTATTTTTCTTTCCTCCACATTCCCTCTGAATCTTCA
TTTTGCACGAACTCTTGAGCAAGTCCCTTGAGGATAGTATGTAAAAAATGTTGGGTCAAAGCCTTTCTGA
CAAAGTAAAATATTTTTAGGAGAAANCAGCACNNAN
Notes:The probe template was PCR amplified from IMAGE:318634 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:318634 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6851 same embryo
 EMAGE:6850 same embryo
 EurExpress:euxassay_002292 same experiment
 MGI:4829178 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS