Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6877

Clns1a chloride channel, nucleotide-sensitive, 1A ( MGI:109638)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6877 EMAGE:6877 EMAGE:6877 EMAGE:6877 EMAGE:6877
"Pseudo-wholemount" of euxassay_002534. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_002534_01 euxassay_002534_02 euxassay_002534_03 euxassay_002534_04
EMAGE:6877 EMAGE:6877 EMAGE:6877 EMAGE:6877 EMAGE:6877
euxassay_002534_05 euxassay_002534_06 euxassay_002534_07 euxassay_002534_08 euxassay_002534_09
EMAGE:6877 EMAGE:6877 EMAGE:6877 EMAGE:6877 EMAGE:6877
euxassay_002534_10 euxassay_002534_11 euxassay_002534_12 euxassay_002534_13 euxassay_002534_14
EMAGE:6877 EMAGE:6877 EMAGE:6877 EMAGE:6877 EMAGE:6877
euxassay_002534_15 euxassay_002534_16 euxassay_002534_17 euxassay_002534_18 euxassay_002534_19
EMAGE:6877 EMAGE:6877 EMAGE:6877 EMAGE:6877
euxassay_002534_20 euxassay_002534_21 euxassay_002534_22 euxassay_002534_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6877Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6877_wholemount_strong.wlz
6877_wholemount_moderate.wlz
6877_wholemount_weak.wlz
6877_wholemount_possible.wlz
6877_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6877_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3026
Entity Detected:Clns1a, chloride channel, nucleotide-sensitive, 1A ( MGI:109638)
Sequence:sense strand is shown

>T3026
TGGCCTCGAGGCCAGATTCGTCGACTCCCTTTGCTGTGTGCGTCTGTCAGCTGCAAGATTCGCCTATGTG
GTGAAATGCACAGAGCTCACACTGGGCGGAAGGGACGTGCGGAAGCTTAGATGTCTCTGGGATTCAGGAG
AACTCTTATCCCTGAGATTAAAAAGCAGAGGCCTCAGAGGGAGCAGCCGCTAGCATTTTCCACAGAGGCA
TGGGTCCTCTACTTGGGGCTCAGCCACATCTCGCAATACTTGTGTGCTAGCTTCTGTTATTCTTCATGTA
CCATCAGCTCTGTTATGTTCTCCTAGGTTAGGTCCTTGACTGTCCACCCTCTTAACGTTCGCTTTCTGTC
ACAGAATAAATAATCTGAAATGAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:1545695 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1545695 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6874 same embryo
 EMAGE:6872 same embryo
 EMAGE:6875 same embryo
 EMAGE:6873 same embryo
 EMAGE:6876 same embryo
 EurExpress:euxassay_002534 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS