Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6886

Ppp2r2b protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform ( MGI:1920180)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6886 EMAGE:6886 EMAGE:6886 EMAGE:6886 EMAGE:6886
"Pseudo-wholemount" of euxassay_007301. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007301_01 euxassay_007301_02 euxassay_007301_03 euxassay_007301_04
EMAGE:6886 EMAGE:6886 EMAGE:6886 EMAGE:6886 EMAGE:6886
euxassay_007301_05 euxassay_007301_06 euxassay_007301_07 euxassay_007301_08 euxassay_007301_09
EMAGE:6886 EMAGE:6886 EMAGE:6886 EMAGE:6886 EMAGE:6886
euxassay_007301_10 euxassay_007301_11 euxassay_007301_12 euxassay_007301_13 euxassay_007301_14
EMAGE:6886 EMAGE:6886 EMAGE:6886 EMAGE:6886 EMAGE:6886
euxassay_007301_15 euxassay_007301_16 euxassay_007301_17 euxassay_007301_18 euxassay_007301_19
EMAGE:6886 EMAGE:6886 EMAGE:6886 EMAGE:6886 EMAGE:6886
euxassay_007301_20 euxassay_007301_21 euxassay_007301_22 euxassay_007301_23 euxassay_007301_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6886Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6886_wholemount_strong.wlz
6886_wholemount_moderate.wlz
6886_wholemount_weak.wlz
6886_wholemount_possible.wlz
6886_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6886_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 20 21 22 23
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 07 moderate expression: see section 20
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 18 19 20 21 22 23
vagus x ganglion
strong strong
regionalstrong expression: see section 19 moderate expression: see section 08 09
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 19 moderate expression: see section 07 08 09 10 18 21 weak expression: see section 20
trigeminal v nerve
strong strong
regionalstrong expression: see section 10 17 18
spinal cord
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17
inner ear
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 21 22 23 24
eyelid
moderate moderate
regionalmoderate expression: see section 03 04 23 24 weak expression: see section 01 02
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 04 23 24
tongue
strong strong
spottedstrong expression: see section 16
tongue muscle
moderate moderate
regionalmoderate expression: see section 13 17 18 weak expression: see section 12 14 15 16
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 weak expression: see section 03 04 12
left lung
moderate moderate
regionalmoderate expression: see section 05 06 07 10 14 weak expression: see section 08 09 11 12 13 15
right lung
moderate moderate
regionalmoderate expression: see section 17 18 19 21 22 23 24 weak expression: see section 16 20
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 06 07 08 19 20
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3010
Entity Detected:Ppp2r2b, protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform ( MGI:1920180)
Sequence:sense strand is shown

>T3010
TGGCCTCGAGGCCAGATTCGGCACGAGGAGTGTTGACAGTCTGGACTTTAGCAAAAAGATCTTGCATACA
GCTTGGCATCCTTCAGAAAACATTATAGCAGTGGCGGCTACGAATAACTTATATATATTCCAAGACAAGG
TTAACTAGAAGGACGAGCTACTACTTAGTCTCACATACTGAATACTAGTCAAAACAAGTTTTTAAATGTT
CCTTTGGGTCTTCATTTTGATGCATTGACTTTCATTTCCCTATGCATAAAACAATTGGAATAGAACTTTT
AAAAGGAGTTCAATGTTCCCCAACTCCCCAATTCTAAGAGACGTCTGTCAAACTCGGTAGGCTTGGGACA
CTTCTGTTTAGACTTGAGAGCTGCCAACTGGCAGGAATTCTTCCATAGTCGACTTGAATTTCTGATGCGT
TCTCGTTCATTGCCCACTTCTCTCTGGTGGGTTCTGTGTTTTGTTTCTAGGTGTCTGCTGCGATAAAATG
AGATTGTCTGTAGTATTTAAGGAGAAAAAGAGATAAGGTTTTTTTTTTAA
Notes:The probe template was PCR amplified from IMAGE:1533427 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1533427 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6887 same embryo
 EurExpress:euxassay_007301 same experiment
 MGI:4827385 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS