Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6926

Akap11 A kinase (PRKA) anchor protein 11 ( MGI:2684060)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6926 EMAGE:6926 EMAGE:6926 EMAGE:6926 EMAGE:6926
"Pseudo-wholemount" of euxassay_007645. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007645_01 euxassay_007645_02 euxassay_007645_03 euxassay_007645_04
EMAGE:6926 EMAGE:6926 EMAGE:6926 EMAGE:6926 EMAGE:6926
euxassay_007645_05 euxassay_007645_06 euxassay_007645_07 euxassay_007645_08 euxassay_007645_09
EMAGE:6926 EMAGE:6926 EMAGE:6926 EMAGE:6926 EMAGE:6926
euxassay_007645_10 euxassay_007645_11 euxassay_007645_12 euxassay_007645_13 euxassay_007645_14
EMAGE:6926 EMAGE:6926 EMAGE:6926 EMAGE:6926 EMAGE:6926
euxassay_007645_15 euxassay_007645_16 euxassay_007645_17 euxassay_007645_18 euxassay_007645_19
EMAGE:6926
euxassay_007645_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6926Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6926_wholemount_strong.wlz
6926_wholemount_moderate.wlz
6926_wholemount_weak.wlz
6926_wholemount_possible.wlz
6926_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6926_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
vertebral axis musculature
weak weak
regionalweak expression: see section 01 02 03 04 05 06 14 15 16 17 18 19 20
forebrain
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
hindbrain
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 02 03 17 18 19
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 04 05 15 16
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 01 02 03 17 18 19 20 weak expression: see section 04 05 06 07 15 16
vagus x ganglion
weak weak
regionalweak expression: see section 06 15
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 04 05 06 15 16
trigeminal v nerve
weak weak
regionalweak expression: see section 07 15
spinal cord
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 11 12
dorsal root ganglion
weak weak
regionalweak expression: see section 03 04 05 06 08 09 10 11 12 13 14 15
neural retina
weak weak
regionalweak expression: see section 01 02
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35918
Entity Detected:Akap11, A kinase (PRKA) anchor protein 11 ( MGI:2684060)
Sequence:sense strand is shown

>T35918
CTCTTTTCAAAGCAGAGTCCGTGTGCTAGTGCTAAGCCAAGTTCACGTTCAAAACTTAGTAGCATTCGTC
AGAAATCAAGAATTTTTCATCTTGATGTACCTCAGATTCATGTTAATCTTGATAAAAGGGCAGTGCTTGC
TGAGAAGATAGTTGCTGAAGCTATTGAGAAAGCAGAGAGAGAGTTGAGCAACACGAGTTTGGCAGCTGAT
AGTGGAATCGGACAAGATGGCATTAGCTTTGCTGAGAGCCTTACTACAGAAATCATGACAACAGCTGTGA
CAAATGCTGGGCATGCTGTTAGCAGTTCAAGAGAAATAGAAGATTTTCAGTCAACTGAGTCACTTGGCAG
CCAGCAGATGAATCTCAGTGTTGGTGAAGACAGCACAGGTAGCTGGTCCAACTTAAGTTTTGAGGATGAC
CATCAAGATGAAAGCAGCAGTTTCCATCATCTCAGTGAAAGCAGTAATGGTAACAGCAGTAGCTGGAGCA
GTCTTGGTTTAGAAGGAGATTTGTATGAGGACAATTTATCCTTTCCAACATCAGACAGTGATGGATCGGA
TGATGGAGATGACGAGCAGGAGGATGGTGTGGAAGATTTGCAGCAAAATGGAAAGACTCTGCTAATTATG
AACATTGACATGGAGCCTGGAGCTGTAGACCCGCAATTAAGGATTATTCTTCAGTGGCTCATTGCCTCTG
AGGCTGAAGTTGCAGAACTTTA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 84831. Forward Primer - name:084831_F_cDNA_Akap11, sequence:CTCTTTTCAAAGCAGAGTCCGT; Reverse Primer - name:084831_N_SP6_cDNA_Akap11, sequence:TAAAGTTCTGCAACTTCAGCC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6924 same embryo
 EMAGE:6927 same embryo
 EMAGE:6923 same embryo
 EMAGE:6928 same embryo
 EMAGE:6925 same embryo
 EurExpress:euxassay_007645 same experiment
 MGI:4823060 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS