Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:703

T brachyury ( MGI:98472)
TS09 (6.25 dpc)
in situ hybridisation

Data Images
EMAGE:703
Figure 6A of Perea-Gomez et al., 2001 [PMID:11171400] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotation: The inset shows a transverse section of the corresponding embryo at the level indicated by the black bar.
Expression Pattern Description
Spatial Annotation:
EMAGE:703Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
703_wholemount_strong_3D_1.wlz
703_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:703_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
embryo ectoderm
detected detected
regionalExpression detected in the posterior epiblast.
embryo mesoderm
detected detected
Expression detected in the nascent mesoderm wings.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:2449091
Entity Detected:T, brachyury ( MGI:98472)
Sequence:sense strand is shown

>MGI:2449091
CCTGGAATTCGTCCACCCCCTGTCCTACTTTAGTGAGACACAAGGTACACCTCTAATGTCCTCCCTTGTT
GCCTTAGAGTAGTTAACTTTGAGGACAGAAAAAAGCATAGCCAGAAGATTGTAACTGAACCGTCAACTGT
TCTGCCCTTGGAACATGCCTACTTTAAGCACACGTAGCTTTTTGTGTTGGGAAGTCAACTGTATGGATAC
TTTTCTGTTGACAAAGTAGCCAAAGACAATCTGCAGAAAGTGTTTTCTGCATAATAAAGGCAATATATAG
CACCTGG
nt 1760 - nt 2046 of X51683.1
Notes:The probe used in this study by Perea-Gomez et al., 2001 [PMID:11171400] is indicated as that described by Wilkinson et al., 1990 [PMID:1689462] ie "from residue 1,760 to the end residue in the 3'-untranslated region of T-gene RNA (Herrmann et al., 1990 [PMID:2154694] )."
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:6.25 dpc
Theiler Stage:TS09
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
General Information
Authors:Perea-Gomez et al., 2001 [PMID:11171400] Indexed by GXD, Spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:11171400] Perea-Gomez A, Lawson KA, Rhinn M, Zakin L, Brulet P, Mazan S, Ang SL 2001 Otx2 is required for visceral endoderm movement and for the restriction of posterior signals in the epiblast of the mouse embryo. Development (128):753-65
 [ doi:10.1038/343617a0] [ PMID:2154694] Herrmann BG, Labeit S, Poustka A, King TR, Lehrach H 1990 Cloning of the T gene required in mesoderm formation in the mouse. Nature (343):617-22
 [ doi:10.1038/343657a0] [ PMID:1689462] Wilkinson DG, Bhatt S, Herrmann BG 1990 Expression pattern of the mouse T gene and its role in mesoderm formation. Nature (343):657-9
Links:MGI:1930281 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI