Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7055

Pfn2 profilin 2 ( MGI:97550)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7055 EMAGE:7055 EMAGE:7055 EMAGE:7055 EMAGE:7055
"Pseudo-wholemount" of euxassay_002518. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_002518_01 euxassay_002518_02 euxassay_002518_03 euxassay_002518_04
EMAGE:7055 EMAGE:7055 EMAGE:7055 EMAGE:7055 EMAGE:7055
euxassay_002518_05 euxassay_002518_06 euxassay_002518_07 euxassay_002518_08 euxassay_002518_09
EMAGE:7055 EMAGE:7055 EMAGE:7055 EMAGE:7055 EMAGE:7055
euxassay_002518_10 euxassay_002518_11 euxassay_002518_12 euxassay_002518_13 euxassay_002518_14
EMAGE:7055 EMAGE:7055 EMAGE:7055 EMAGE:7055 EMAGE:7055
euxassay_002518_15 euxassay_002518_16 euxassay_002518_17 euxassay_002518_18 euxassay_002518_19
EMAGE:7055 EMAGE:7055 EMAGE:7055 EMAGE:7055
euxassay_002518_20 euxassay_002518_21 euxassay_002518_22 euxassay_002518_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7055Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7055_wholemount_strong.wlz
7055_wholemount_moderate.wlz
7055_wholemount_weak.wlz
7055_wholemount_possible.wlz
7055_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7055_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
homogeneousmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 23 weak expression: see section 21 22
vibrissa
moderate moderate
regionalmoderate expression: see section 05 06 07 18 19
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 08
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 17 18 19 weak expression: see section 20 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 18
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 07 08 19
spinal cord
moderate moderate
homogeneousmoderate expression: see section 10 11 12 13 14 15 16
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 09
cervical ganglion
moderate moderate
regionalmoderate expression: see section 17 weak expression: see section 09
thoracic ganglion
weak weak
regionalweak expression: see section 11 12 13
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 16 17
cornea stroma
moderate moderate
regionalmoderate expression: see section 01 02 03 04 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3416
Entity Detected:Pfn2, profilin 2 ( MGI:97550)
Sequence:sense strand is shown

>T3416
GCTGCCCCTTCCCCTTAAATAATTGTGTTCATTTTTGTTTTGTTTCCTTGTGTACTCCAGCATTGGTTAT
AGTCATGGGAAAGGAAGGTGTCCACGCAGGCACAATTAACAAGAAAACATATGAACTCGCTTTATACCTG
AAGAGGTCTGTAACCAACCTTTATCTGGCATCATAATTGCAGCACAATAATGATTTGCATGATATCTTGA
AACTGGGGGAAGGGGGCATGCCAAGTTGGGCATCACTTCGTCTTAGCAGTTAGTGGATTACTGATTACTA
AAATAGGTTAATAGTAAGCAAGGTGCCGGTGTACAGTCTCTAACTCGATCAGTGTCTTTTCAGCACTTTG
GAGCATTTCCTTGGCTCATCTAGTCTTCCTTTTGTAGCGCATGGTTGGGAGGAAAAAGTGCATGCCTCTG
TACGTCACACCTTTCTCACCCCTCCCTACCAACACGAGGTGTTTGGTCTGCTTCCATTCTCTTCTGTGTA
GTGCCTGGTTTATTTAACTAATTAATACCTCCTCTGTTG
Notes:The probe template was PCR amplified from IMAGE:3025761 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3025761 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7059 same embryo
 EMAGE:7058 same embryo
 EMAGE:7056 same embryo
 EMAGE:7057 same embryo
 EMAGE:7054 same embryo
 EurExpress:euxassay_002518 same experiment
 MGI:4827168 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS