Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:72

Fgf8 fibroblast growth factor 8 ( MGI:99604)
TS10 (7.0 dpc)
in situ hybridisation

Data Images
EMAGE:72
Figure 4D (left hand embryo) of Tremblay et al., 2001 [PMID:11566864] . Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:72Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
72_wholemount_strong_3D_1.wlz
72_wholemount_moderate_3D_1.wlz
72_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:72_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
primitive streak
detected detected
allantois mesoderm
detected detected
regionalExpression detected at the base of the allantois.
embryo mesoderm
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1334951
Entity Detected:Fgf8, fibroblast growth factor 8 ( MGI:99604)
Sequence:sense strand is shown

>MGI:1334951
AGAACGCCAAGTACGAGGGCTGGTACATGGCCTTTACCCGCAAGGGCCGGCCCCGCAAGGGCTCCAAGAC
GCGCCAGCATCAGCGCGAGGTGCACTTCATGAAGCGCCTGCCGCGGGGCCACCACACCACCGAGCAGAGC
CTGCGCTTCGAGTTCCTCAACTACCCGCCCTTCACGCGCAGCCTGCGCGGCAGCCAGAGGACTTGGGCCC
CGGAGCCCCGATAGGCGCTCGCCCAGCTCCTCCCCACCCAGCCGGCCGAGGAATCCAGCGGGAGCTCGGC
GGCACAGCAAAGGGGAGGGGCTGGGGAGCTGCCTTCTAGTTGTGCATATTGTTTGCTGTTGGGTTTTTTT
GTTTTTTGTTTTTTGTTTTTGTTTTTTGTTTTTTAAACAAAAGAGAGGCG
nt 598 - nt 997 of D12482.1
Notes:Probe used in this study by Tremblay et al., 2001 [PMID:11566864] is indicated as being described by Crossley & Martin, 1995 [PMID:7768185] ie. a "400 nt cDNA probe containing the 3' UTR and C-terminal coding sequences up to the PstI site at nt position 598 in AIGF (Tanaka et al., 1992 [PMID:1409588] )".
Chemistry:RNA
Strand:antisense
Label:undefined
Specimen
Organism:mouse
Age:7.0 dpc
Theiler Stage:TS10
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Staining procedure:undefined
General Information
Authors:Tremblay et al., 2001 [PMID:11566864] Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:11566864] Tremblay KD, Dunn NR, Robertson EJ 2001 Mouse embryos lacking Smad1 signals display defects in extra-embryonic tissues and germ cell formation. Development (128):3609-21
 [ PMID:7768185] Crossley PH, Martin GR 1995 The mouse Fgf8 gene encodes a family of polypeptides and is expressed in regions that direct outgrowth and patterning in the developing embryo. Development (121):439-51
 [ doi:10.1073/pnas.89.19.8928] [ PMID:1409588] Tanaka A, Miyamoto K, Minamino N, Takeda M, Sato B, Matsuo H, Matsumoto K 1992 Cloning and characterization of an androgen-induced growth factor essential for the androgen-dependent growth of mouse mammary carcinoma cells. Proc Natl Acad Sci U S A (89):8928-32
Links:MGI:2155905 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI