Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7255

Apba1 amyloid beta (A4) precursor protein binding, family A, member 1 ( MGI:1860297)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7255 EMAGE:7255 EMAGE:7255 EMAGE:7255 EMAGE:7255
"Pseudo-wholemount" of euxassay_007658. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007658_01 euxassay_007658_02 euxassay_007658_03 euxassay_007658_04
EMAGE:7255 EMAGE:7255 EMAGE:7255 EMAGE:7255 EMAGE:7255
euxassay_007658_05 euxassay_007658_06 euxassay_007658_07 euxassay_007658_08 euxassay_007658_09
EMAGE:7255 EMAGE:7255 EMAGE:7255 EMAGE:7255 EMAGE:7255
euxassay_007658_10 euxassay_007658_11 euxassay_007658_12 euxassay_007658_13 euxassay_007658_14
EMAGE:7255 EMAGE:7255 EMAGE:7255 EMAGE:7255 EMAGE:7255
euxassay_007658_15 euxassay_007658_16 euxassay_007658_17 euxassay_007658_18 euxassay_007658_19
EMAGE:7255
euxassay_007658_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7255Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7255_wholemount_strong.wlz
7255_wholemount_moderate.wlz
7255_wholemount_weak.wlz
7255_wholemount_possible.wlz
7255_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7255_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 11 weak expression: see section 10 12 13
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 05 10 11 weak expression: see section 07 08 13 14
pons mantle layer
moderate moderate
regionalmoderate expression: see section 05 weak expression: see section 06 07 08 17
facial vii ganglion
moderate moderate
single cellmoderate expression: see section 18 weak expression: see section 02 03 04
glossopharyngeal ix ganglion
moderate moderate
single cellmoderate expression: see section 05 06 15 weak expression: see section 16
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 05 06 15 17 18 weak expression: see section 01 02 03 04 16 19
ventral grey horn
moderate moderate
regionalmoderate expression: see section 08 09 11 12 13 weak expression: see section 10
dorsal root ganglion
moderate moderate
single cellmoderate expression: see section 05 06 weak expression: see section 07 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35937
Entity Detected:Apba1, amyloid beta (A4) precursor protein binding, family A, member 1 ( MGI:1860297)
Sequence:sense strand is shown

>T35937
CCCAGTGACCACAGTGCTAATAAGGAGGCCGGACCTTCGCTACCAGCTGGGTTTCAGCGTACAGAATGGA
ATTATCTGCAGCCTCATGAGAGGGGGAATCGCTGAGAGAGGAGGCGTCCGCGTGGGACATCGGATCATCG
AAATCAATGGCCAGAGTGTCGTAGCCACACCACACGAGAAGATCGTCCACATCCTCTCCAATGCTGTTGG
GGAGATCCACATGAAGACAATGCCAGCAGCCATGTACCGACTGCTGACGGCCCAGGAGCAGCCCGTTTAC
ATCTGAGCAGAATCTCCGTGATGTGGCGTGGTGTGGCGTGGCGTGGCATGGCGTAGCGGCATGCATGGAG
GACTCTCCTCACCGTGGTTGTGTTTTTTGTGCTGCACCCGTGTGTCCACTGAGACATTCCCCTCTGGCGC
CCAACATTTGGTCTTACACGGGAAGAGAAGAATCAGCAAGGACCTCTTTGCTCTCTGTCTCTCTCCAGTT
TGTTTGGTTTTTTTCTTTCTTTCTTTCTTTCTTTCTTTTTTTTCTTTTCTGTTCCTTCCTTAATACCAGG
GAAGTTTTGTGTGTGCCCTCTTGAGGGTGGAGAGCAGCTAATATCTCCCTGGGATCATGGTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 69312. Forward Primer - name:069312_F_cDNA_Apba1, sequence:CCCAGTGACCACAGTGCTAATA; Reverse Primer - name:069312_N_SP6_cDNA_Apba1, sequence:CACCATGATCCCAGGGAGATA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7258 same embryo
 EMAGE:7257 same embryo
 EMAGE:7259 same embryo
 EMAGE:7256 same embryo
 EMAGE:7254 same embryo
 EurExpress:euxassay_007658 same experiment
 MGI:4823167 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS