Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7814

Nob1 NIN1/RPN12 binding protein 1 homolog (S. cerevisiae) ( MGI:1914869)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7814 EMAGE:7814 EMAGE:7814 EMAGE:7814 EMAGE:7814
"Pseudo-wholemount" of euxassay_007565. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007565_01 euxassay_007565_02 euxassay_007565_03 euxassay_007565_04
EMAGE:7814 EMAGE:7814 EMAGE:7814 EMAGE:7814 EMAGE:7814
euxassay_007565_05 euxassay_007565_06 euxassay_007565_07 euxassay_007565_08 euxassay_007565_09
EMAGE:7814 EMAGE:7814 EMAGE:7814 EMAGE:7814 EMAGE:7814
euxassay_007565_10 euxassay_007565_11 euxassay_007565_12 euxassay_007565_13 euxassay_007565_14
EMAGE:7814 EMAGE:7814 EMAGE:7814 EMAGE:7814 EMAGE:7814
euxassay_007565_15 euxassay_007565_16 euxassay_007565_17 euxassay_007565_18 euxassay_007565_19
EMAGE:7814 EMAGE:7814 EMAGE:7814 EMAGE:7814
euxassay_007565_20 euxassay_007565_21 euxassay_007565_22 euxassay_007565_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7814Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7814_wholemount_strong.wlz
7814_wholemount_moderate.wlz
7814_wholemount_weak.wlz
7814_wholemount_possible.wlz
7814_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7814_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 19 20
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 05 06 17
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 15 16 17 18 19 20 21
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 06 07 17
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 16 17 18 19
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 08 15
spinal cord
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 08 14
cervical ganglion
moderate moderate
regionalmoderate expression: see section 07 15 16
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 11 12
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 13 14 15 16 17
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35372
Entity Detected:Nob1, NIN1/RPN12 binding protein 1 homolog (S. cerevisiae) ( MGI:1914869)
Sequence:sense strand is shown

>T35372
GAAACTGCTCTGCACATTTCTGGCTTCCATCTGCCCTCCAAGTCTAAACCCTTACAAGAAGCAGTGGATC
GGGGCCACGCAGCTGATGGGCCCGAGAACCTGGAGTTCAGCTCCTTCATGTTCTGGAGGACCCCGCTGCC
TAACATTGACCGTGAGCTGCAGGAGCTGCTGATTGATGGAAGGGAGGAGGAAGAGGAGGAGGAGGAGTGT
GAAGACAGTGATGACGATGGTGGTGGGTGGATAACCCCCAGCAACATAAAGCAGATCCAGCAGGAGTTGG
AGCAGTGTGACACCCCAGAGGACGTGCAGGTTGGCTGTGTGACCACGGACTTCGCCATGCAGAATGTTCT
ACTTCAGATGGGGCTGCACGTGTTGGCGGTGAACGGCATGCTGGTCCGAGAGGCCCGGAGCTACATCCTG
CGCTGTCATGGCTGTTTCAAGACGACATCGGACATGAACCGAGTGTTCTGTGGACATTGTGGGAACAAGA
CCCTGAAGAAAGTGTCTGTGACTATCAATGACGATGGGACCTTGCACATGCATTTCTCCCGAAACCCGAA
AGTTCTGAACCCAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 64965. Forward Primer - name:064965_F_cDNA_1700021I09Rik, sequence:GAAACTGCTCTGCACATTTCTG; Reverse Primer - name:064965_N_SP6_cDNA_1700021I09Rik, sequence:GTGGGTTCAGAACTTTCGGGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7813 same embryo
 EurExpress:euxassay_007565 same experiment
 MGI:4826739 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS