Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7836

Adam10 a disintegrin and metallopeptidase domain 10 ( MGI:109548)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7836 EMAGE:7836 EMAGE:7836 EMAGE:7836 EMAGE:7836
"Pseudo-wholemount" of euxassay_007598. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007598_01 euxassay_007598_02 euxassay_007598_03 euxassay_007598_04
EMAGE:7836 EMAGE:7836 EMAGE:7836 EMAGE:7836 EMAGE:7836
euxassay_007598_05 euxassay_007598_06 euxassay_007598_07 euxassay_007598_08 euxassay_007598_09
EMAGE:7836 EMAGE:7836 EMAGE:7836 EMAGE:7836 EMAGE:7836
euxassay_007598_10 euxassay_007598_11 euxassay_007598_12 euxassay_007598_13 euxassay_007598_14
EMAGE:7836 EMAGE:7836 EMAGE:7836 EMAGE:7836 EMAGE:7836
euxassay_007598_15 euxassay_007598_16 euxassay_007598_17 euxassay_007598_18 euxassay_007598_19
EMAGE:7836 EMAGE:7836 EMAGE:7836 EMAGE:7836 EMAGE:7836
euxassay_007598_20 euxassay_007598_21 euxassay_007598_22 euxassay_007598_23 euxassay_007598_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7836Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7836_wholemount_strong.wlz
7836_wholemount_moderate.wlz
7836_wholemount_weak.wlz
7836_wholemount_possible.wlz
7836_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7836_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
pectoral girdle and thoracic body wall musculature
strong strong
regionalstrong expression: see section 03 04 05 06 20 21 22
facial vii ganglion
strong strong
regionalstrong expression: see section 18 21
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 06 07 17 18
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 16 17 18 19 20 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07 18
dorsal root ganglion
strong strong
regionalstrong expression: see section 07 08 09 10 13 14 15 16 17 18
inner ear
strong strong
regionalstrong expression: see section 02 03 04 18 19 20 21 22 moderate expression: see section 05 06 07 16 17
lens
strong strong
regionalstrong expression: see section 01 23 24
neural retina
strong strong
regionalstrong expression: see section 01 02 03 21 22 23
anterior naris
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14
external naris
moderate moderate
regionalmoderate expression: see section 14
nasal cavity epithelium
moderate moderate
regionalmoderate expression: see section 18
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17
naso-lacrimal duct
strong strong
regionalstrong expression: see section 06 moderate expression: see section 07 08 16 17 18 19 20 21
liver
strong strong
regionalstrong expression: see section 01 02 03 04 05 moderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35878
Entity Detected:Adam10, a disintegrin and metallopeptidase domain 10 ( MGI:109548)
Sequence:sense strand is shown

>T35878
CATGCTGCTAGTAGTGGTCCTGAGCTCCTGAGGAAAAAACGCACAACTCTGGCTGAAAGAAATACTTGTC
AGCTCTATATCCAGACAGATCACCTGTTCTTTAAATACTATGGAACACGAGAAGCTGTGATTGCTCAGAT
ATCCAGTCATGTTAAAGCAATTGATACAATTTACCAGACTACAGACTTCTCCGGAATCCGTAACATCAGC
TTCATGGTGAAACGCATAAGAATCAATACAACCTCTGATGAAAAAGACCCTACAAATCCTTTCCGTTTCC
CAAATATTGGTGTGGAGAAGTTCCTGGAGTTGAATTCTGAGCAGAATCATGATGACTACTGCCTGGCCTA
TGTCTTCACAGACCGGGATTTTGATGATGGTGTTCTTGGTCTGGCCTGGGTTGGAGCACCTTCAGGAAGC
TCTGGGGGAATATGTGAGAAAAGCAAGTTGTATTCAGATGGCAAGAAGAAGTCATTGAACACAGGCATCA
TTACTGTTCAGAACTATGGCTCCCATGTGCCTCCCAAAGTCTCTCATATTACGTTTGCTCATGAAGTTGG
ACATAACTTTGGATCTCCACATGATTCTGGAACAGAGTGTACTCCAGGAGAGTCTAAGAACTTAGGACAA
AAAGAAAATGGCAATTACATCATGTATGCAAGAGCAACATCTGGGGACAAACTTAACAACAACAAATTTT
CACTCTGCAGCATTAGAAACATAAGCCAAGTGCTTGAGAAGAAGAGGAACAACTGTTTTGTTGAATCTGG
CCAGCCTATCTGTGGAAACGGGATGGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 97299. Forward Primer - name:097299_F_cDNA_Adam10, sequence:CATGCTGCTAGTAGTGGTCCTG; Reverse Primer - name:097299_N_SP6_cDNA_Adam10, sequence:ACCATCCCGTTTCCACAGATA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7835 same embryo
 EMAGE:7833 same embryo
 EMAGE:7834 same embryo
 EMAGE:7831 same embryo
 EMAGE:7832 same embryo
 EurExpress:euxassay_007598 same experiment
 MGI:4822971 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS