Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7873

Arrb1 arrestin, beta 1 ( MGI:99473)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7873 EMAGE:7873 EMAGE:7873 EMAGE:7873 EMAGE:7873
"Pseudo-wholemount" of euxassay_012804. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012804_01 euxassay_012804_02 euxassay_012804_03 euxassay_012804_04
EMAGE:7873 EMAGE:7873 EMAGE:7873 EMAGE:7873 EMAGE:7873
euxassay_012804_05 euxassay_012804_06 euxassay_012804_07 euxassay_012804_08 euxassay_012804_09
EMAGE:7873 EMAGE:7873 EMAGE:7873 EMAGE:7873 EMAGE:7873
euxassay_012804_10 euxassay_012804_11 euxassay_012804_12 euxassay_012804_13 euxassay_012804_14
EMAGE:7873 EMAGE:7873 EMAGE:7873 EMAGE:7873 EMAGE:7873
euxassay_012804_15 euxassay_012804_16 euxassay_012804_17 euxassay_012804_18 euxassay_012804_19
EMAGE:7873 EMAGE:7873 EMAGE:7873 EMAGE:7873 EMAGE:7873
euxassay_012804_20 euxassay_012804_21 euxassay_012804_22 euxassay_012804_23 euxassay_012804_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7873Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7873_wholemount_strong.wlz
7873_wholemount_moderate.wlz
7873_wholemount_weak.wlz
7873_wholemount_possible.wlz
7873_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7873_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
moderate moderate
homogeneousmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
telencephalon mantle layer
moderate moderate
homogeneousmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
medulla oblongata alar plate mantle layer
moderate moderate
homogeneousmoderate expression: see section 09 10 11 12 13 14 15 16 17 18 19
medulla oblongata basal plate mantle layer
moderate moderate
homogeneousmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
rest of cerebellum mantle layer
moderate moderate
homogeneousmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
pons mantle layer
moderate moderate
homogeneousmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain mantle layer
moderate moderate
homogeneousmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20
facial vii ganglion
strong strong
regionalstrong expression: see section 05 06 22 moderate expression: see section 20 21
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 18 moderate expression: see section 07 08 19
trigeminal v ganglion
strong strong
regionalstrong expression: see section 05 06 17 18 22 23 moderate expression: see section 04 07 08 09 19 20 21
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 09
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 07 weak expression: see section 08 09 18 19
trigeminal v nerve
weak weak
regionalweak expression: see section 09
spinal cord mantle layer
moderate moderate
homogeneousmoderate expression: see section 10 11 12 13 14 15 16 17
dorsal root ganglion
strong strong
regionalstrong expression: see section 09 16 17 19 moderate expression: see section 08 10 11 12 13 18
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 23 weak expression: see section 22 24
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 14 15
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 15
liver lobe
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
bladder
weak weak
regionalExpression in the fundus region.
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38171
Entity Detected:Arrb1, arrestin, beta 1 ( MGI:99473)
Sequence:sense strand is shown

>T38171
TTCTGCAAGGTCTATACGCTGACTCCCTTCCTGGCCAACAACCGAGAGAAGCGGGGACTCGCCCTCGACG
GGAAGCTCAAGCATGAGGACACGAATCTGGCTTCCAGCACGCTGTTGCGGGAAGGTGCCAACCGTGAAAT
CCTGGGCATCATCGTTTCCTACAAAGTCAAGGTGAAACTGGTGGTGTCCCGGGGCGGCCTCTTGGGAGAC
CTTGCATCCAGTGATGTGGCCGTGGAGCTGCCTTTTACCCTAATGCACCCCAAGCCTAAGGAGGAGCCCC
CACATCGGGAAGTTCCAGAGAGCGAGACTCCAGTAGACACCAATCTCATAGAGCTTGACACCAATGATGA
CGACATTGTATTTGAGGACTTTGCTCGCCAGCGGCTGAAAGGCATGAAGGATGACAAGGACGAAGAGGAT
GACGGCACCGGCTCTCCGCACCTCAACAACAGATAGACTAGGGCCGGCCTCAGCCCGGCAGCTCCAGGTT
CACTCTCGCACTCGGATGCTTTCTCGTCTCCTTCCCATTCTGGTTCTTCCTTTTGTTCTTCCAGTTTCTA
CCAAGGGGCCCCAGTGGTCTTCCAAGTCTCGGTGATGGGCCTCTCGCATCACCACGCCAGCAGGACCACG
TCCTCAGCCATCTCTCTGCAATCACCTGGCCACCTCCTTCTCATGCTCATTCCCAGGAAGGCCACACTGC
CTGGCCTTGGGATTTGGCTTGAGATGGGGAGCAGAAAGGGGAGGGTGGGGCCTGAAGGCACAATGATGAT
GGGTGTGAAGATGTGGAGGGGGTGGGCAAGATGGCTCAAGACACACAAGAAGATGTCTGTAGTCCCAGTA
GGTGACAGTTTTGGCAGCTAAATGATGACCAGATTGAAGGTGGGAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 103502. Forward Primer - name:103502_F_cDNA_Arrb1, sequence:TTCTGCAAGGTCTATACGCTGA; Reverse Primer - name:103502_N_SP6_cDNA_Arrb1, sequence:CTCCCACCTTCAATCTGGTCA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7875 same embryo
 EMAGE:7874 same embryo
 EMAGE:7872 same embryo
 EurExpress:euxassay_012804 same experiment
 MGI:4823257 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS