Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7875

Astn2 astrotactin 2 ( MGI:1889277)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7875 EMAGE:7875 EMAGE:7875 EMAGE:7875 EMAGE:7875
"Pseudo-wholemount" of euxassay_012805. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012805_01 euxassay_012805_02 euxassay_012805_03 euxassay_012805_04
EMAGE:7875 EMAGE:7875 EMAGE:7875 EMAGE:7875 EMAGE:7875
euxassay_012805_05 euxassay_012805_06 euxassay_012805_07 euxassay_012805_08 euxassay_012805_09
EMAGE:7875 EMAGE:7875 EMAGE:7875 EMAGE:7875 EMAGE:7875
euxassay_012805_10 euxassay_012805_11 euxassay_012805_12 euxassay_012805_13 euxassay_012805_14
EMAGE:7875 EMAGE:7875 EMAGE:7875 EMAGE:7875 EMAGE:7875
euxassay_012805_15 euxassay_012805_16 euxassay_012805_17 euxassay_012805_18 euxassay_012805_19
EMAGE:7875 EMAGE:7875 EMAGE:7875 EMAGE:7875
euxassay_012805_20 euxassay_012805_21 euxassay_012805_22 euxassay_012805_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7875Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7875_wholemount_strong.wlz
7875_wholemount_moderate.wlz
7875_wholemount_weak.wlz
7875_wholemount_possible.wlz
7875_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7875_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
trunk mesenchyme
moderate moderate
regionalmoderate expression: see section 09 19 20 weak expression: see section 07 08
vibrissa
weak weak
regionalweak expression: see section 04 05 06 18 19 20
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
olfactory cortex mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 14 15 16 17
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 17 18 weak expression: see section 16
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 17 18 weak expression: see section 16
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 weak expression: see section 22
pons mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 17 18 19 weak expression: see section 16
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 weak expression: see section 04 20 21
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 08 17 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 17 18 19 weak expression: see section 03 04 20 21 22
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 07 08 17 18 19
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 weak expression: see section 16
dorsal root ganglion
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 16 17
pharyngo-tympanic tube
weak weak
regionalweak expression: see section 01 02 03 22 23
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 07 08 09 10 11 13 14 15 16 17
vomeronasal organ
weak weak
regionalweak expression: see section 10 11 14
trachea
weak weak
regionalweak expression: see section 13
tail mesenchyme
weak weak
regionalweak expression: see section 13 14 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38172
Entity Detected:Astn2, astrotactin 2 ( MGI:1889277)
Sequence:sense strand is shown

>T38172
TGTACTTCCACGTTTCCATGAGCAGCTCTGGGCAACTGGCTCAGGCCACTGCTCCCACACTCCAGGAGCC
CTCGGAGATCGTTGAGGAACAGATGCATATCCTCCACATTTCTGTGATGGGTGGACTCATTGCACTTCTC
CTCCTGCTGTTGGTGTTCACAGTGGCACTGTATGCCCAGCGACGCTGGCAGAAGCGCCGGCGCATCCCAC
AGAAGAGCGCAAGTACAGAAGCTACTCATGAGATTCACTACATCCCATCAGTGCTGCTGGGTCCTCAGGC
CAGGGAAAGCTTCCGATCCTCCAGACTTCAGACACACAACTCAGTCATTGGTGTGCCTATCCGGGAAACC
CCCATCCTGGATGACTATGACTATGAAGAGGAGGAGGAACCACCCAGGCGAGCCAACCACGTCTCCCGTG
AGGATGAGTTTGGTAGCCAGATGACCCATGCCCTGGACAGCTTGGGAAGGCCAGGAGAAGAGAAAGTGGA
ATTTGAGAAGAAAGGGGGAATCAGCTTTGGGAGAACCAAGGGGACATCAGGCTCAGAAGCAGATGACGAA
ACACAGCTGACCTTCTACACAGAGCAGTACCGCAGTCGCCGCCGCAGCAAAGGTTTACTGAAAAGCCCTG
TGAATAAGACAGCCTTAACACTGATTGCTGTGAGCTCCTGCATCTTGGCCATGGTGTGTGGCAACCAGAT
GTCCTGTCCACTTACTGTGAAGGTGACTTTGCATGTGCCTGAACACTTCATTGCAGATGGGAGCAGCTTT
GTGGTGAGTGAAGGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 103517. Forward Primer - name:103517_F_cDNA_Astn2, sequence:TGTACTTCCACGTTTCCATGAG; Reverse Primer - name:103517_N_SP6_cDNA_Astn2, sequence:TCCTTCACTCACCACAAAGCTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7873 same embryo
 EMAGE:7874 same embryo
 EMAGE:7872 same embryo
 EurExpress:euxassay_012805 same experiment
 MGI:4823283 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS