Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7882

Clcn3 chloride channel 3 ( MGI:103555)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7882 EMAGE:7882 EMAGE:7882 EMAGE:7882 EMAGE:7882
"Pseudo-wholemount" of euxassay_012819. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012819_01 euxassay_012819_02 euxassay_012819_03 euxassay_012819_04
EMAGE:7882 EMAGE:7882 EMAGE:7882 EMAGE:7882 EMAGE:7882
euxassay_012819_05 euxassay_012819_06 euxassay_012819_07 euxassay_012819_08 euxassay_012819_09
EMAGE:7882 EMAGE:7882 EMAGE:7882 EMAGE:7882 EMAGE:7882
euxassay_012819_10 euxassay_012819_11 euxassay_012819_12 euxassay_012819_13 euxassay_012819_14
EMAGE:7882 EMAGE:7882 EMAGE:7882 EMAGE:7882 EMAGE:7882
euxassay_012819_15 euxassay_012819_16 euxassay_012819_17 euxassay_012819_18 euxassay_012819_19
EMAGE:7882 EMAGE:7882 EMAGE:7882 EMAGE:7882 EMAGE:7882
euxassay_012819_20 euxassay_012819_21 euxassay_012819_22 euxassay_012819_23 euxassay_012819_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7882Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7882_wholemount_strong.wlz
7882_wholemount_moderate.wlz
7882_wholemount_weak.wlz
7882_wholemount_possible.wlz
7882_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7882_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hypothalamus ventricular layer
weak weak
regionalweak expression: see section 11 13
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 11 12 13
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 09 12 13 14 15 16 17
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 weak expression: see section 03 04 19 20
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 17 weak expression: see section 07 08 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 05 17 weak expression: see section 03 04 06 07 08 16 18 19 20 21
ventral grey horn
weak weak
regionalweak expression: see section 10 11 12 14 15
dorsal root ganglion
weak weak
regionalweak expression: see section 08 09 10 11 15 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38195
Entity Detected:Clcn3, chloride channel 3 ( MGI:103555)
Sequence:sense strand is shown

>T38195
TAGATGAGCCTATCCCAGGTGTCGGTACCTACGATGATTTCCATACTATTGACTGGGTGCGAGAGAAGTG
TAAGGACAGAGAAAGGCACAGACGGATCAACAGTAAAAAAAAAGAATCAGCATGGGAAATGACAAAAAGT
CTGTATGACGCCTGGTCAGGATGGCTTGTCGTTACACTGACGGGACTGGCATCAGGGGCACTAGCTGGAT
TGATAGACATTGCTGCTGACTGGATGACTGACCTGAAGGAGGGCATCTGCCTCAGTGCATTGTGGTACAA
CCATGAACAGTGTTGTTGGGGCTCTAATGAGACAACGTTTGAAGAGAGGGATAAATGTCCACAGTGGAAA
ACATGGGCAGAGTTAATCATTGGCCAAGCAGAGGGCCCTGGATCTTATATCATGAACTACATCATGTATA
TCTTTTGGGCTTTGAGTTTTGCCTTTCTTGCAGTTTCTTTGGTGAAAGTATTTGCTCCATATGCCTGTGG
CTCTGGAATTCCAGAGATTAAAACTATTTTGAGTGGATTTATCATCAGAGGATACTTGGGAAAATGGACT
TTAATGATTAAAACTATCACGTTAGTGCTGGCTGTGGCATCAGGTTTGAGTTTAGGAAAAGAAGGTCCCC
TGGTACATGTTGCCTGCTGCTGTGGAAATATCTTTTCCTACCTCTTTCCAAAGTATAGCACCA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 103587. Forward Primer - name:103587_F_cDNA_Clcn3, sequence:TAGATGAGCCTATCCCAGGTGT; Reverse Primer - name:103587_N_SP6_cDNA_Clcn3, sequence:TGGTGCTATACTTTGGAAAGAGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7883 same embryo
 EMAGE:7886 same embryo
 EMAGE:7884 same embryo
 EMAGE:7885 same embryo
 EMAGE:7887 same embryo
 EurExpress:euxassay_012819 same experiment
 MGI:4823900 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS