Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:791

Crabp1 cellular retinoic acid binding protein I ( MGI:88490)
TS17 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:791
cp1 10.5 10x frop.tvs 7.2.02

Expression pattern clarity: three stars
Find spatially similar expression patterns: Find spatially similar patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:791EMAGE:791Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D context movie

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
791_voxel_strong_3D_1.wlz
791_voxel_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:791_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: two stars
Annotation Validation: submitter
Detection Reagent
Type:in situ hybridisation probe
Identifier:Crapb1 cloneA
Entity Detected:Crabp1, cellular retinoic acid binding protein I ( MGI:88490)
Sequence:sense strand is shown

>Crapb1 cloneA
TGGCCAACGATGAGCTAATCCTGACATTTGGCGCCGATGATGTGGTGTGCACAAGAATTTATGTCCGGGA
GTAAAGGTGGCCAGCTTGTTCCTGCTTCATGACCGGATGCGAGTTCCCCTGAGGAGTATGCCGTGGCCCC
ACACTGCCAGTGGGTCTTTACTCCACACACCTCTCCCCCATGAATATTAGGCAACCCCATTTTCCCCATG
ACATTGTTGTAGTGTCCTCCCCTCAGGCTCTTGTTGCCTTGTGTACCCTTGGTTTGGCATTTGCATGATT
GTACCAGTCATTAAACTGGTTGGCTGC
nt 435 - nt 741 of NM_013496.1
Notes:The probe used in this study by Bennetts & Wicking covers exon 4 and the entire 3'UTR. Vector - pGEMTeasy. Antisense - NcoI/Sp6; Sense - SalI/T7 Conc of probe used in hyb 0.5-1microgram/ml
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:10.5 dpc
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:wholemount plus section of wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Jennifer Bennetts & Carol Wicking.
Principal investigator:Carol Wicking, Institute for Molecular Bioscience, Institute for Molecular Bioscience University of Queensland St Lucia, Brisbane, Australia 4072
Submitted by:Jennifer Bennetts, Institute for Molecular Bioscience, Institute for Molecular Bioscience University of Queensland St Lucia, Brisbane, Australia 4072
Experiment type:non-screen
References:[ doi:10.1002/gene.10165] [ PMID:12533789] Fowles LF, Bennetts JS, Berkman JL, Williams E, Koopman P, Teasdale RD, Wicking C 2003 Genomic screen for genes involved in mammalian craniofacial development. Genesis (35):73-87
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE