Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7914

Colec12 collectin sub-family member 12 ( MGI:2152907)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7914 EMAGE:7914 EMAGE:7914 EMAGE:7914 EMAGE:7914
"Pseudo-wholemount" of euxassay_010114. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010114_01 euxassay_010114_02 euxassay_010114_03 euxassay_010114_04
EMAGE:7914 EMAGE:7914 EMAGE:7914 EMAGE:7914 EMAGE:7914
euxassay_010114_05 euxassay_010114_06 euxassay_010114_07 euxassay_010114_08 euxassay_010114_09
EMAGE:7914 EMAGE:7914 EMAGE:7914 EMAGE:7914 EMAGE:7914
euxassay_010114_10 euxassay_010114_11 euxassay_010114_12 euxassay_010114_13 euxassay_010114_14
EMAGE:7914 EMAGE:7914 EMAGE:7914 EMAGE:7914 EMAGE:7914
euxassay_010114_15 euxassay_010114_16 euxassay_010114_17 euxassay_010114_18 euxassay_010114_19
EMAGE:7914 EMAGE:7914 EMAGE:7914 EMAGE:7914 EMAGE:7914
euxassay_010114_20 euxassay_010114_21 euxassay_010114_22 euxassay_010114_23 euxassay_010114_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7914Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7914_wholemount_strong.wlz
7914_wholemount_moderate.wlz
7914_wholemount_weak.wlz
7914_wholemount_possible.wlz
7914_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7914_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 14 15 16 17 18 19 20 21 22 23 24
pericardium
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
peritoneal component
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
pleura
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
humerus
strong strong
regionalstrong expression: see section 01 02 03 04 05 20 21 22 23 24
fibula
strong strong
regionalstrong expression: see section 03 04
tibia
strong strong
regionalstrong expression: see section 01 02 03 04
femur
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 20 21 22 23 24
mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
diencephalon meninges
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
telencephalon meninges
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
hindbrain meninges
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
midbrain meninges
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
spinal cord meninges
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17 18
otic capsule
strong strong
regionalstrong expression: see section 09 10 16 17 18 19 20
naris
strong strong
regionalstrong expression: see section 09 10 12 13
viscerocranium
strong strong
regionalExpression in the turbinate bone.
esophagus
strong strong
regionalstrong expression: see section 12 13
stomach
strong strong
regionalstrong expression: see section 03 moderate expression: see section 02 04 05 06 07 08 09 10
midgut
strong strong
regionalstrong expression: see section 13 14 15 16 17 18 19 moderate expression: see section 11 12
urinary system mesentery
strong strong
regionalstrong expression: see section 08 09 10 11 17 18 19 20 21 22
left lung
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12
right lung
strong strong
regionalstrong expression: see section 12 13 14 15 16 17 18 19 20 21 22 23 24
trachea
strong strong
regionalstrong expression: see section 14
axial skeleton
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 18
basioccipital bone
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
basisphenoid bone
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
temporal bone petrous part
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 24
vault of skull
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
orbito-sphenoid
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 21 22 23 24
clavicle
strong strong
regionalstrong expression: see section 08 09 16 17 18 19
scapula
strong strong
regionalstrong expression: see section 05 22 23
sternum
strong strong
regionalstrong expression: see section 13
pelvic girdle skeleton
strong strong
regionalstrong expression: see section 10 11 12 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31787
Entity Detected:Colec12, collectin sub-family member 12 ( MGI:2152907)
Sequence:sense strand is shown

>T31787
ACTCCAAGCACGGTCAGCTCATCAAGAACTTTACCATTCTACAAGGTCCTCCTGGCCCCAGAGGTCCAAA
AGGTGACAGAGGATCTCAGGGACCACCTGGTCCAACTGGCAACAAGGGACAGAAAGGAGAGAAGGGAGAG
CCTGGTCCACCTGGCCCTGCGGGTGAGAGGGGCACAATTGGACCAGTCGGCCCTCCTGGAGAGCGTGGCA
GCAAAGGATCCAAAGGCTCACAGGGTCCCAAAGGATCTCGTGGGTCCCCAGGGAAGCCTGGCCCTCAAGG
ACCTAGTGGGGACCCAGGACCACCAGGTCCACCAGGCAAGGATGGACTCCCTGGCCCTCAGGGCCCTCCT
GGCTTCCAGGGACTACAGGGCACTGTGGGTGAGCCTGGAGTACCTGGACCTCGGGGGTTGCCAGGCTTGC
CAGGGGTGCCAGGCATGCCTGGGCCTAAGGGACCACCTGGCCCTCCAGGCCCCTCAGGAGCAATGGAGCC
ATTGGCTCTGCAGAATGAACCAACCCCAGCATCAGAGGTCAACGGATGTCCGCCTCACTGGAAGAACTTC
ACAGATAAATGCTACTATTTTTCATTGGAAAAAGAAATTTTTGAAGATGCTAAGCTTTTCTGTGAAGACA
AATCTTCCCATCTCGTTTTCATAAACTCAAGAGAAGAACAGCAATGGATAAAAAAGCATACCGTGGGGAG
AGAAAGCCATTGGATCGGCCTCACAGACTCAGAACAGGAAAGCGAATGGAAGTGGCTAGACGGGTCACCT
GTTGATTACAAAAACTGGAAAGCTGGACAACCAGATAACTGGGGCAGTGGCCATGGGCCAGGAGAAGACT
GTGCTGGCTTGATTTACGCAGGACAGTGGAATGACTTCCAGTGTGATGAAATCAATAACTTCATTTGTGA
GAAGGAAAGGGAGGCAGTACCATCATCCATATTATAACAGCATGATATAATAGCAGAAACATATTTTCTG
ATGCCTCTGAAAGCCGAA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:5326386), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 60203. Forward Primer - name:060203_F_IRAV97_g09_Colec12, sequence:ACTCCAAGCACGGTCAGC; Reverse Primer - name:060203_R_SP6_IRAV97_g09_Colec12, sequence:CTTCGGCTTTCAGAGGCA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7911 same embryo
 EMAGE:7912 same embryo
 EMAGE:7915 same embryo
 EMAGE:7910 same embryo
 EMAGE:7913 same embryo
 EurExpress:euxassay_010114 same experiment
 MGI:4823998 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS