Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7918

Cxx1a CAAX box 1 homolog A (human) ( MGI:1913408)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7918 EMAGE:7918 EMAGE:7918 EMAGE:7918 EMAGE:7918
"Pseudo-wholemount" of euxassay_012953. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012953_01 euxassay_012953_02 euxassay_012953_03 euxassay_012953_04
EMAGE:7918 EMAGE:7918 EMAGE:7918 EMAGE:7918 EMAGE:7918
euxassay_012953_05 euxassay_012953_06 euxassay_012953_07 euxassay_012953_08 euxassay_012953_09
EMAGE:7918 EMAGE:7918 EMAGE:7918 EMAGE:7918 EMAGE:7918
euxassay_012953_10 euxassay_012953_11 euxassay_012953_12 euxassay_012953_13 euxassay_012953_14
EMAGE:7918 EMAGE:7918 EMAGE:7918 EMAGE:7918 EMAGE:7918
euxassay_012953_15 euxassay_012953_16 euxassay_012953_17 euxassay_012953_18 euxassay_012953_19
EMAGE:7918 EMAGE:7918 EMAGE:7918
euxassay_012953_20 euxassay_012953_21 euxassay_012953_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7918Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7918_wholemount_strong.wlz
7918_wholemount_moderate.wlz
7918_wholemount_weak.wlz
7918_wholemount_possible.wlz
7918_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7918_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
facial vii ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 18 19 20
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 05 06 17
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 16 17 18 19 20 21
vagus x ganglion
strong strong
regionalstrong expression: see section 07 16 17
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 05 06 07 16 17
trigeminal v nerve
strong strong
regionalstrong expression: see section 08 15
spinal cord
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 08 09 14
cervical ganglion
moderate moderate
regionalmoderate expression: see section 07 08 15 16
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 10 11 12 13
dorsal root ganglion
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 14 15 16 17
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 20 21 22
metanephros
strong strong
regionalstrong expression: see section 07 08 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38867
Entity Detected:Cxx1a, CAAX box 1 homolog A (human) ( MGI:1913408)
Sequence:sense strand is shown

>T38867
GATCCCCTACATCAAGATCGACAGCCCCCTGCTCAATGATTACAACGGCTTCCTGAATGAGATGAAGCGG
GTGTTCGGGTGGGAGGAGGATGAGGACTTCTAGGCCTCTGGCAAGCCTGGCCTGGGGTTGGGGCTCCGGG
AGGGTGGGCTGCTGCTGTGTTGTCCTGTGGCTGCAGCCGGGGTCGCCGAGTGCGCCCTCCCCCCGGGCCC
CCCTCCTACCCCGAGAACTCCCCCACCTCCCGCGCCCGCCCTGCCTGGAGATCTCGCATGCGCGCGCCCC
TGTCTCCTCCTGTGTCCTAGCCTTTGTTCCAGGAATAGCTCCCCAGGCCCCTGCTGCTGTCCCTGCTGGG
CCTGGCTCTGGAGAGCACAAGGCCTCCCACTGTTGACAGCTCAGCCCATCCCTGGCAGGTTTGGACACTG
TCCCAGGCTCCAGCTGCAAGATGGGCTCCTGTCACCTAATGGACAGATCACCTGCCAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 177531. Forward Primer - name:177531_F_cDNA_1110012O05Rik, sequence:GATCCCCTACATCAAGATCGAC; Reverse Primer - name:177531_N_SP6_cDNA_1110012O05Rik, sequence:GTGGCAGGTGATCTGTCCATT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7917 same assay
 EMAGE:7922 same embryo
 EMAGE:7919 same embryo
 EMAGE:7921 same embryo
 EMAGE:7920 same embryo
 EurExpress:euxassay_012953 same experiment
 EMAGE:7916 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS