Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7939

Mustn1 musculoskeletal, embryonic nuclear protein 1 ( MGI:1913425)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7939 EMAGE:7939 EMAGE:7939 EMAGE:7939 EMAGE:7939
"Pseudo-wholemount" of euxassay_012979. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012979_01 euxassay_012979_02 euxassay_012979_03 euxassay_012979_04
EMAGE:7939 EMAGE:7939 EMAGE:7939 EMAGE:7939 EMAGE:7939
euxassay_012979_05 euxassay_012979_06 euxassay_012979_07 euxassay_012979_08 euxassay_012979_09
EMAGE:7939 EMAGE:7939 EMAGE:7939 EMAGE:7939 EMAGE:7939
euxassay_012979_10 euxassay_012979_11 euxassay_012979_12 euxassay_012979_13 euxassay_012979_14
EMAGE:7939 EMAGE:7939 EMAGE:7939 EMAGE:7939 EMAGE:7939
euxassay_012979_15 euxassay_012979_16 euxassay_012979_17 euxassay_012979_18 euxassay_012979_19
EMAGE:7939 EMAGE:7939 EMAGE:7939 EMAGE:7939 EMAGE:7939
euxassay_012979_20 euxassay_012979_21 euxassay_012979_22 euxassay_012979_23 euxassay_012979_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7939Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7939_wholemount_strong.wlz
7939_wholemount_moderate.wlz
7939_wholemount_weak.wlz
7939_wholemount_possible.wlz
7939_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7939_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
weak weak
regionalweak expression: see section 01 02 03 04 21 22 23 24
upper leg muscle
weak weak
regionalweak expression: see section 01 02 03 04 05 16 17 18 19 20 21 22 23
diaphragm
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 18 19 20 21 22 23 24
pericardial cavity
weak weak
regionalweak expression: see section 17
forearm rest of mesenchyme
weak weak
regionalweak expression: see section 01
hand
weak weak
regionalweak expression: see section 02 23
lower leg rest of mesenchyme
weak weak
regionalweak expression: see section 01 02 03 21 22 23 24
vertebral axis musculature
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
eye skeletal muscle
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 19 20 21 22 23 24
tongue muscle
weak weak
regionalweak expression: see section 10 11 12 13 14 15 16
tail paraxial mesenchyme
weak weak
regionalweak expression: see section 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39082
Entity Detected:Mustn1, musculoskeletal, embryonic nuclear protein 1 ( MGI:1913425)
Sequence:sense strand is shown

>T39082
CAGATCCTTTCCTGTGGCTACTGCCTGCCAGAGAGCTACCAACAGCGAGCTTGCTTGGCATCCAACATGT
CCGAGGCTGGCACTCCTGAAGGCCCCATCAAGAAGAAGCGGCCCCCTGTGAAGGAAGAAGACCTGAAGGG
GGCCCGAGGGACCCTGGCCAAGAACCAGGACATCAAGTCTAAGACATACCAGGTCATGCGGGACTACGAG
CAAGCCGGCTCAGCTGCCCCATCTGTATTCAGCCGCAACCGCACAGGCACCGAGACAGTCTTTGAGAAGC
CCAAAGAGGGACCAGCCAAGAGCGTGTTTGGCTGAGACATGCACATTGCACCATCCACCCGGACACAGGA
GCCTCCCCACGAACTTTTTTTTTTTTGTAATGCTGGAAGATGCCTTTCCTCTGCTGTCTCTTGAACCATC
ATGACTCCCACAACCCTAGCCCTTGGAAACACCAATAAAGAGTATGCCCAATGTCCCCAACCTTGGGACG
TTGCCATGGCCGCTACCTGCAGAAGAGAGGGAAGTGTGGGGACATAGCATATCTGGTGCCCTTCCTGGAC
TCTGAGGTGGGACAGGGAATAATGTGTGTGCTCTCAGAACCACTGAGGTGTTCCAGGCAGAGCCTTAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 71008. Forward Primer - name:071008_F_cDNA_Mustn1, sequence:CAGATCCTTTCCTGTGGCTACT; Reverse Primer - name:071008_N_SP6_cDNA_Mustn1, sequence:CTAAGGCTCTGCCTGGAACAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7940 same embryo
 EurExpress:euxassay_012979 same experiment
 MGI:4826515 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS