Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7955

Gm2515 predicted gene 2515 ( MGI:3780682)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7955 EMAGE:7955 EMAGE:7955 EMAGE:7955 EMAGE:7955
"Pseudo-wholemount" of euxassay_013138. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013138_01 euxassay_013138_02 euxassay_013138_03 euxassay_013138_04
EMAGE:7955 EMAGE:7955 EMAGE:7955 EMAGE:7955 EMAGE:7955
euxassay_013138_05 euxassay_013138_06 euxassay_013138_07 euxassay_013138_08 euxassay_013138_09
EMAGE:7955 EMAGE:7955 EMAGE:7955 EMAGE:7955 EMAGE:7955
euxassay_013138_10 euxassay_013138_11 euxassay_013138_12 euxassay_013138_13 euxassay_013138_14
EMAGE:7955 EMAGE:7955 EMAGE:7955 EMAGE:7955 EMAGE:7955
euxassay_013138_15 euxassay_013138_16 euxassay_013138_17 euxassay_013138_18 euxassay_013138_19
EMAGE:7955 EMAGE:7955 EMAGE:7955 EMAGE:7955 EMAGE:7955
euxassay_013138_20 euxassay_013138_21 euxassay_013138_22 euxassay_013138_23 euxassay_013138_24
EMAGE:7955
euxassay_013138_25

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7955Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7955_wholemount_strong.wlz
7955_wholemount_moderate.wlz
7955_wholemount_weak.wlz
7955_wholemount_possible.wlz
7955_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7955_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
moderate moderate
spottedmoderate expression: see section 01 02 03 04 05 06 20 21 22 23 24 25
upper leg muscle
moderate moderate
spottedmoderate expression: see section 04 05 06 07 08 weak expression: see section 02 03 18 19 20 21 22 24 25
rib
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 18 19 20 21 22 23 24 25
diaphragm
moderate moderate
spottedmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25
forearm rest of mesenchyme
moderate moderate
spottedmoderate expression: see section 01 02 03 04
hand
moderate moderate
spottedmoderate expression: see section 02 03 04 05 06 07
foot
moderate moderate
spottedmoderate expression: see section 05 06 07 08 weak expression: see section 23 24 25
lower leg rest of mesenchyme
weak weak
spottedweak expression: see section 01 02 03 24 25
vertebral axis musculature
moderate moderate
spottedmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 15 16
pons mantle layer
moderate moderate
regionalmoderate expression: see section 07 17
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 09 15 16 17
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 09 10 11 12 13 15 16 17 18 19
vomeronasal organ
strong strong
regionalstrong expression: see section 13 15
esophagus
strong strong
regionalstrong expression: see section 12
mandible
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 15 16 17 18 19 20 21 22 moderate expression: see section 01 02 03 04
maxilla
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 15 16 17 18 19 20 21
left lung
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12
right lung
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18 19 20 21 22 23 24 25
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 05 22 23 24 25
tail paraxial mesenchyme
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39458
Entity Detected:Gm2515, predicted gene 2515 ( MGI:3780682)
Sequence:sense strand is shown

>T39458
CTTAATGGTCTGAGTTCCAGGGCAGCTCCCTCACCAGGGCAGCCTGTGGTCGCTGACCTCCAGGGGATGC
TCCAGCCCTCTGGGATGCCCACTGAAACCCCAAAACCTAACCCCTCCAACACCTCACCCCCAGAGTCTCC
TGAGTCTGTATACACTGACCCCACACCAACTCTACACCATGAATCCCCTGAAATCTCCAAAAGAGATACC
CCCAAACTCTCACCTGGTGAAGAGTCTAAGATACCAAGTCCCAGACCCACCCAATTCCTCAGCTCCAAAT
CCCTAGAGACCTACGACCCCAGTGCCACGAGACACCTAAATTCTGCACTGGAACCAACCACCCACCCTGA
CCCTACAGAAAGTCCACAGTCAGTCTTTCTCACCACTCACAACTCTAATCCCACTGTTGTCCCCCAAACC
CAATTCCCCACATCCCCCAGCCAAAATGTAACAGAAACGGCTAGGACCTCTGACTTGGAACCCAGCTCTA
GTCTTCCCACCCAGCCAACAACCTTCAGGGAGGAAGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 80403. Forward Primer - name:080403_F_cDNA_LOC210541, sequence:CTTAATGGTCTGAGTTCCAGGG; Reverse Primer - name:080403_N_SP6_cDNA_LOC210541, sequence:GCTTCCTCCCTGAAGGTTGTT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7953 same embryo
 EMAGE:7956 same embryo
 EMAGE:7958 same embryo
 EMAGE:7954 same embryo
 EMAGE:7957 same embryo
 EurExpress:euxassay_013138 same experiment
 MGI:4825095 same experiment
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS