Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7983

Plcl1 phospholipase C-like 1 ( MGI:3036262)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7983 EMAGE:7983 EMAGE:7983 EMAGE:7983 EMAGE:7983
"Pseudo-wholemount" of euxassay_013151. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013151_01 euxassay_013151_02 euxassay_013151_03 euxassay_013151_04
EMAGE:7983 EMAGE:7983 EMAGE:7983 EMAGE:7983 EMAGE:7983
euxassay_013151_05 euxassay_013151_06 euxassay_013151_07 euxassay_013151_08 euxassay_013151_09
EMAGE:7983 EMAGE:7983 EMAGE:7983 EMAGE:7983 EMAGE:7983
euxassay_013151_10 euxassay_013151_11 euxassay_013151_12 euxassay_013151_13 euxassay_013151_14
EMAGE:7983 EMAGE:7983 EMAGE:7983 EMAGE:7983 EMAGE:7983
euxassay_013151_15 euxassay_013151_16 euxassay_013151_17 euxassay_013151_18 euxassay_013151_19
EMAGE:7983 EMAGE:7983 EMAGE:7983 EMAGE:7983 EMAGE:7983
euxassay_013151_20 euxassay_013151_21 euxassay_013151_22 euxassay_013151_23 euxassay_013151_24
EMAGE:7983 EMAGE:7983 EMAGE:7983
euxassay_013151_25 euxassay_013151_26 euxassay_013151_27

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7983Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7983_wholemount_strong.wlz
7983_wholemount_moderate.wlz
7983_wholemount_weak.wlz
7983_wholemount_possible.wlz
7983_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7983_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vibrissa
weak weak
regionalweak expression: see section 05 06 07 21 22 23 24
diencephalon lateral wall mantle layer
weak weak
regionalweak expression: see section 12 13 16
telencephalon mantle layer
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 18 19 20 21 22 23 24 25 26
olfactory cortex mantle layer
weak weak
regionalweak expression: see section 11 12 13 16 17
medulla oblongata alar plate mantle layer
weak weak
regionalweak expression: see section 10 11 12 17 18
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 10 11 12 13 15 16 17 18
pons mantle layer
weak weak
regionalweak expression: see section 09 20 21
midbrain floor plate
weak weak
regionalweak expression: see section 14 15
ventral grey horn
moderate moderate
regionalmoderate expression: see section 15 weak expression: see section 13 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39526
Entity Detected:Plcl1, phospholipase C-like 1 ( MGI:3036262)
Sequence:sense strand is shown

>T39526
AGAATCCTACCTCCCATCACCTGAAAAACTAAAAAATATGATTATTGTGAAAGGAAAGAAATTGCCTTCG
GAATCAGATCTGTTAGAAGGAGAAGTGACCGACGAGGACGAAGAAGCCGAGATGTCGCGGAGGATGTCAG
GGGATTACAACGGTGAGCAGAAACATATCTGGCTCTGCCGAGAGCTCTCTGACTTGGTATCCATCTGCAA
ATCTGTTCAGCACAGGGATTTTGAACTGTCTATGAAAACCCAAAACTACTGGGAAATGTGTTCATTTAGT
GAAACAGAGGCCAGCCGGATTGCCAATGAATACCCAGAGGACTTCGTGAATTATAACAAGAAGTTCTTAT
CAAGGGTCTACCCTAGTGCCATGCGGATAGATTCCAGTAATTTGAACCCACAGGACTTCTGGAACTGTGG
CTGTCAGATTGTGGCGATGAATTTTCAAACTCCCGGTCCAATGATGGACCTCCACACTGGCTGGTTTCTT
CAAAATGGAGGATGTGGCTACGTCCTCAGGCCATCTATCATGCGAGATGAAGTTTCGTACTTCAGCGCAA
ATACAAAGGGCATTGTCCCTGGCGTGTCTCCCCTGGTTCTTCACATCAAGATCATCAGTGGTCAGAACTT
CCCAAAGCCCAAAGGAGCCTGTGCCAAAGGGGATGTCATAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 75607. Forward Primer - name:075607_F_cDNA_Plcl1, sequence:AGAATCCTACCTCCCATCACCT; Reverse Primer - name:075607_N_SP6_cDNA_Plcl1, sequence:CTATGACATCCCCTTTGGCAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7985 same embryo
 EMAGE:7988 same embryo
 EMAGE:7989 same embryo
 EMAGE:7984 same embryo
 EMAGE:7986 same embryo
 EMAGE:7987 same embryo
 EurExpress:euxassay_013151 same experiment
 MGI:4827257 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS